Skip to main content

Advertisement

Table 3 Primer pair A: To amplify actin gene, B: Real time primer for TapAPX gene, C: To amplify full length TapAPX gene with restriction sites shown in italics

From: Molecular cloning and in-silico characterization of high temperature stress responsive pAPX gene isolated from heat tolerant Indian wheat cv. Raj 3765

S. no. Gene Primer sequence Sequence amplified
A Actin F 5′ GAAGCTGCAGGTATCCATGAGACC3′ 151 bp
R 5′ AGGCAGTGATCTCCTTGCTCATC3′
B TapAPX F 5′ GATGCTAAGAAAGGCGCACCACAT3′ 124 bp
R 5′ AGGCACATCCTGAAAGGTCTGGTT3′
C TapAPX F 5′ CGCGGATCC ATGGCGGCTCCGGTGGTGGACG3′ 876 bp
R 5′CGAGCTC TTACTTGCTCCTCTTGGAAGCCTCGTACAG3′