Skip to main content

Advertisement

Table 1 Primers used for PCR analysis of known virulence genes of extra-intestinal pathogenic E. coli

From: Adherent-invasive Escherichia coli (AIEC) in pediatric Crohn’s disease patients: phenotypic and genetic pathogenic features

Virulence traits Genes Primer sequence (5′à 3′) Expected amplicon size (bp) References
P fimbriae papA ATGGCAGTGGTGTCTTTTGGTG 720 [33]
CGTCCCACCATACGTGCTCTTC
papEF GCAACAGCAACGCTGGTTGCATCAT 336 [33]
AGAGAGAGCCACTCTTATACGGACA
P pili-associated G-adhesins papC GACGGCTGTACTGCAGGGTGTGGCG 328 [33]
ATATCCTTTCTGCAGGGATGCAATA
Pyelonephritis-associated pili papG allele II e III CTGTAATTACGGAAGTGATTTCTG 1070 [33]
ACTATCCGGCTCCGGATAAACCAT
papG allele II GGGATGAGCGGGCCTTTGAT 190 [33]
CGGGCCCCCAAGTAACTCG
papG allele III GGCCTGCAATGGATTTACCTGG 258 [33]
CCACCAAATGACCATGCCAGAC
S and F1C fimbriae sfa//focDE CTCCGGAGAACTGGGTGCATCTTAC 410 [33]
CGGAGGAGTAATTACAAACCTGGCA
F1C fimbriae focG CAGCACAGGCAGTGGATACGA 360 [33]
GAATGTCGCCTGCCCATTGCT
Dr-binding adhesin afa/draBC GGCAGAGGGCCGGCAACAGGC 559 [33]
CCCGTAACGCGCCAGCATCTC
G fimbriae gafD TGTTGGACCGTCTCAGGGCTC 952 [33]
CTCCCGGAACTCGCTGTTACT
Nonfimbrial adhesin type 1 nfaE GCTTACTGATTCTGGGATGGA 559 [33]
CGGTGGCCGAGTCATATGCCA
Mannose-specific adhesion gene. Type1 fimbriae. fimH TGCAGAACGGATAAGCCGTGG 508 [33]
GCAGTCACCTGCCCTCCGGTA
Haemolysin A hlyA AACAAGGATAAGCACTGTTCTGGCT 1177 [33]
ACCATATAAGCGGTCATTCCCGTCA
Cytotoxic necrotizing factor 1 cnf1 GTGATAATATATCACATTATTC 498 [33]
GAATTCGTCTCGTTGAGCTTCACTG
Yersiniabactin siderophore receptor fyuA TGATTAACCCCGCGACGGGAA 880 [33]
CGCAGTAGGCACGATGTTGTA
Aerobactin siderophore receptor iutA GGCTGGACATCATGGGAACTGG 300 [33]
CGTCGGGAACGGGTAGAATCG
Capsule synthesis primers kpsMT II GCGCATTTGCTGATACTGTTG 272 [33]
CATCCAGACGATAAGCATGAGCA
kpsMT III TCCTCTTGCTACTATTCCCCCT 392 [33]
AGGCGTATCCATCCCTCCTAAC
kpsMT1 (K1) TAGCAAACGTTCTATTGGTGC 153 [33]
CATCCAGACGATAAGCATGAGCA
kpsMT 5 (K5) CAGTATCAGCAATCGTTCTGTA 159 [33]
CATCCAGACGATAAGCATGAGCA
Invasion of brain endothelium gene (associate with neonatal meningitis) IbeA AGGCAGGTGTGCGCCGCGTAC 170 [33]
TGGTGCTCCGGCAAACCATGC
Encodes colicin V cvaC CACACACAAACGGGAGCTGTT 680 [33]
CTTCCCGCAGCATAGTTCCAT
Serum resistance gene traT GGTGTGGTGCGATGAGCACAG 290 [33]
CACGGTTCAGCCATCCCTGAG
Pathogenicity islands described in a virulent uropathogen. PAI GGACATCCTGTTACAGCGCGCA 930 [33]
TCGCCACCAATCACAGCCGAAC
Transcriptional Activator gene of aggregative adhesion fimbriae aggR GTATACACAAAAGAAGGAAGC 254 [34]
ACAGAATCGTCAGCATCAGC
CVD432 gene probe sequence of the plasmid of aggregative adhesion pAA (CVD432) CTGGCCAAAGACTGTATCAT 630 [34]
CAATGTATAGAAATCCGCTGTT