Sugar metabolism, chip color, invertase activity, and gene expression during long-term cold storage of potato (Solanum tuberosum) tubers from wild-type and vacuolar invertase silencing lines of Katahdin

Table 1 Sequences and concentrations of primers used for quantitative PCR

Gene (Accession)	Forward primer, concentration	Reverse primer, concentration
Actin 97 (TC164213)	atgttcccgggtattgctgacaga, 0.4	ctgcctttgcaatccacatctgct, 0.4
AGPase (AY186620)	ggagtccgattcaatgtgagaagaag, 0.4	ccaaaacactccggctagcatc, 0.4
GBSS (EU403426)	tacacaagagtggaacccagcgac, 0.4	tgtcaacaggcaagccaactgc, 0.4
INH (FJ810207)	caccctacaatccgatccacgta, 0.4	tcgccacgtaacactggctaagt, 0.4
SPS (BQ510597)	tccacaggtcgcaagagtatcagg, 0.8	ccggataaaacacttcgctcccac, 0.2
SuSy (AJ537575)	tttgaggcctggtgtctgggaataca, 0.4	tccattcgaggctccgtcgacaa, 0.4
VInv (TC163068)	aaacgggttggacacatcat, 0.2	aacccaattccacaatccaa, 0.2

All sequences are given 5′-3′, and concentrations are μM. Abbreviations: AGPase ADP-glucose pyrophosphorylase small subunit, GBSS granule-bound starch synthase, INH invertase inhibitor 3, SPS sucrose phosphate synthase 2, SuSy sucrose synthase 4, VInv vacuolar acid invertase. Accessions for Actin 97 and VInv are from the Gene Index Project; all others are from GenBank.

ISSN: 1756-0500