Skip to main content

Table 2 Primer sequences

From: Gene expression of tendon markers in mesenchymal stromal cells derived from different sources

Equine gene Forward primer Reverse primer Accession number PCR product in bp
ACTB ATCCACGAAACTACCTTCAAC CGCAATGATCTTGATCTTCATC NM_001081838.1 174
GAPDH TGGAGAAAGCTGCCAAATACG GGCCTTTCTCCTTCTCTTGC NM_001163856.1 309
Collagen 1A2 CAACCGGAGATAGAGGACCA CAGGTCCTTGGAAACCTTGA XM_001492939.1 243
Collagen 3A1 AGGGGACCTGGTTACTGCTT TCTCTGGGTTGGGACAGTCT XM_001917620.2 216
Decorin ACCCACTGAAGAGCTCAGGA GCCATTGTCAACAGCAGAGA NM_001081925.2 239
Tenascin-C TCACATCCAGGTGCTTATTCC CTAGAGTGTCTCACTATCAGG XM_001916622.2 163
SleraxisnaT TACCTGGGTTTTCTTCTGGTCACT TATCAAAGACACAAGATGCCAGC NM_001105150.1 51
ScleraxisMSC AGAGAAAGTTGAGCAAGGACC TCAAAGACACAAGATGCCAGC NM_001105150.1 294
  1. Primer sequences used for real-time reverse transcription polymerase chain reaction.