Skip to main content

Advertisement

Table 2 Primer pairs used to generate amplicons for the TILLING screen of six genes, as detailed in the methods

From: Development and evaluation of a cucumber TILLING population

Gene Amplicon External primers Internal primers (M13 tag bold)
PDS-3 pdsB Pds3for1, CACAGATGACATTCTTCCCAAT pds3for3, CACGACGTTGTAAAACGAC TCTAACATACCCATAGG
Pds3rev2, CCTAGTTCTACCCTTTGTTCTTGG pds3rev4, ATAACAATTTCACACAGG GTTTCATGCTGGCTGCC
  pdsD Pds3for5, GGAAATTTGTCTCAACATGTGTGC Pds3for7, CACGACGTTGTAAAACGAC TCTCCAAACTAGTGAC
Pds3rev6, CTTGTGCCACATGGCTAGAATAG Pds3rev8, GATAACAATTTCACACAGG CTGCCGGTGATGCTGG
  pdsF Pds3for9, AAGGGGCTCGACTGTTCAGAAA Pds3for11, CACGACGTTGTAAAACGAC CACTAGAAGACTCAGC
Pds3rev10, CTGGTAGTGATTCTCGGTTTCA Pds3rev12, GATAACAATTTCACACAGG CATCCACCGAAGTAGA
Female acsA AcsFor1, GAACTATCTACCATATTCCAACC AcsFor2, CACGACGTTGTAAAACGAC GTACCTATATACCTCACCTCAACAT
AcsRev3, CACCAACTCGAAAACCTGGGAGCC AcsRev1, GGATAACAATTTCACACAGG CCTCGTCTTCGTTACTCCTCTCCT
  acsB AcsFor5, TTGATAGAGATTTGAAATGGAGA AcsFfor6, CACGACGTTGTAAAACGAC CCGGAGTTGAGATTGTGCCAATTC
AcsRev7F, CCGAGTGCACTTTTCTTTTTC AcsRev5, GGATAACAATTTCACACAGG ATTCCCCCAAATATGGATGATG
RMS-3 rms3A Rms3for1, GTGTCACCGTGCATGCAATTGCCG Rms3for2, GTACACTTCAAATCATAAACGGCTG
Rms3Rev2, TTCATCTCTCAGTTTTCCTACCTAAT Rms3Rev1, GGGTTACAAACGCTGGCCTTC
  rms3B Rms3for6, ATTGCAAACATAGCCATCAAAATC Rms3for7, GTCAAAATTATCATTTCTACGCAGG
Rms3rev6, CAAGTAAAAACACAGCTCTCAACCT Rms3Rev5, GAGTGGATGCTATTCCTTTTCGATG
RMS-4 rms4A Rms4for5, CTCTCTCCGTTGCTAAGACAAACCC Rms4for1, TCCGATTACTGTATCTTCCTGCTCG
Rms4rev6, CAAACTCACCATTGTTCTCAAACCC Rms4rev1, CGACAGCGATTCAAGCCCTTGACAA
  rms4B Rms4For4, TTCTCGTGGCCAATCCTCTGAC Rms4for2, CCATTACCGAGGCTTGCCCTAACCT
Rms4rev5, GCCCCACAAATCATTACCACTGCAT Rms4rev2, GCCCCACAAATCATTACCACTGCAT
  rmsC Rms4G3for7, GGATGGAAACTATGGTGGATATA Rms4for3, CCAGGTACTCCACCGACGCTGATTG
Rms4G3rev7, CCCATGAAAGATTGTGAAATCACA Rms4rev3, GTGATACAGCTAATCTCAAAGTAAC
Cum-1 Cum1B Cum1for1, GCTCTTTTCCTCATCAGGTTAGTG Cum1for3, ACGACGTTGTAAAACGAC TCTCCTGCTCATTCCAC
Cum1rev2, GTATACACCAAACTGAGAACCAG Cum1rev4, GATAACAATTTCACACAGG TACAACCCAGATTCCC
  Cum1D Cum1for5, GATATCAATTAAACCATGCGGGC Cum1for7, CACGACGTTGTAAAACGAC TGGTATGAAATGGGGG
Cum1rev6, GATTATCGGTTTCATCTCCATGG Cum1rev8, GATAACAATTTCACACAGG CCCAATTCAGACCTTC
SP spB SPfor1, GGACAGCACAAGAAAAGGTCAC SPfor2, CACGACGTTGTAAAACGAC TGCCTCTCTCTCTGCT
SPrev1, CACATCATTTCTTGCCAATTGTC SPrev2, GATAACAATTTCACACAGG GGGCATCTTTTGCAAC
  spC SPfor1, GGACAGCACAAGAAAAGGTCAC SPfor3, CACGACGTTGTAAAACGAC CAACCAATTCCCAAAC
SPrev1, CACATCATTTCTTGCCAATTGTC SPrev3, GATAACAATTTCACACAGG CACTCTCTCTCACCAG
  1. The bold portion of the internal primers corresponds to the M13 tail that binds a third pair of universal primers that were fluorescently labeled. The corresponding internal primers of Rms-3 and Rms-4 were directly labeled.