Skip to main content

Advertisement

Table 1 Information on the primers used in this study

From: Development of Loop-Mediated Isothermal Amplification (LAMP) assay for rapid detection of Fusarium oxysporum f. sp. ciceris - wilt pathogen of chickpea

Primer name Sequence (5′- 3′) Length (bp)
F3 ACAACCTCAATGAGTGCG 18
B3 CATGAGCGACAACATACCA 19
FIP (F1C + F2) CCAGGCGTACTTGAAGGAACC 41
GTCAAGCAGTCACTAACCAT
BIP (B1C + B2) AGCGTGAGCGTGGTATCAC 37
ACGGTGACATAGTAGCGA
LoopF GCTCAGCGGCTTCCTATT 18
LoopB CTCTGGAAGTTCGAGCATCC 20
ITS-1 TCCGTAGGTGAACCTGCGG 19
ITS-4 TCCTCCGCTTATTGATATGC 20