Skip to main content

Advertisement

Table 1 Characterization of the polymorphic microsatellite loci identified in Fucus vesiculosus

From: Polymorphic microsatellite markers in the brown seaweed Fucus vesiculosus

Locus Repeat motif Primer sequence (5′-3′) T a (°C) Allele size range (bp) n H E H O F IS PIC f NL
Fves1 (ATC)9 F: GCAGGATCGACAACCATACC 58 103-181 12 0.83 0.23 0.7 0.8 0.56
R: GATCCCACCGACATGCTTTG
Fves2 (AC)12 F: TGTATCAGCATACGGAAAAGC 56 100-112 7 0.76 0.63 0.16 0.71 0.06
R: ATCAGGCATGTTGTCGTCGG
Fves5 (TG)11 F: CGATGGGGGATGAGTGATTG 56 124-180 9 0.65 0.75 −0.15 0.6 0
R: TGACATGCGGAGACAAAACG
Fves7 (AC)11 F: ACTTGATGTCCAGAATGAATGGG 56 191-213 6 0.68 0.25 0.6 0.62 0.25
R: AGGTGTGCGTGCGATTATTAC
Fves8 (CA)16 F: TGGGGAAGTACACACACACG 56 137-169 6 0.50 0.4 0.23 0.45 0.09
R: TCGTTGCGGTACTAACTTTGC
Fves10 (TG)11 F: AGGCGCTTGAAAATGACCTG 56 103-169 6 0.47 0.2 0.6 0.44 0.4
R: CCCGTGATTACTTTGGTATCGTC
Fves11 (AC)15 F: TGTGTGACCTTCCTCCTGTG 56 133-147 5 0.45 0.43 0.04 0.41 0
R: AGTATTGGCGTGTGCAACTG
Fves12 (GT)17 F: AACTTTACCCGTTTTCCACG 58 107-159 18 0.82 0.85 −0.05 0.78 0
R: CTCGCGGTAGAACACCTCTC
Fves14 (AG)17 F: AATGACGGGGCCGGAATG 56 112-138 9 0.82 0.7 0.19 0.78 0.1
R: GGCCGTCCGATCTTACTCAC
  1. The following details are reported: name, motif, primer sequence and annealing temperature (Ta°C). Also descriptive statistics are presented, based on one population analysed, number of alleles n, expected heterozygosity, H E, observed heterozygosity, H O, F IS according to Hardy-Weinberg equilibrium, polymorphic information content, PIC, and null allele frequencies, f NL. Bold numbers indicate significant values at 5% level after q-value correction.