Skip to main content

Table 3 Characterization of the 72 polymorphic SSR markers developed for U. humidicola

From: Microsatellite markers for Urochloa humidicola (Poaceae) and their transferability to other Urochloa species

SSR locus GenBank accession number Repeat motif Ta (°C) a Primer sequences (5′-3′) Urochloa species accessions* U. humidicola accessions**
Size range (bp) A b PIC c A b PIC c DP d
BhUNICAMP068 KM068303 (CACACC)4(CA)17 58.5 F_CCACAAACGTGAACACATACA R_AGGGACGGAAACACCCTTAG 226-261 10 0.87 10 0.87 0.95
BhUNICAMP069 KM068304 (TC)25 64.5 F_GAGGAACTCCTTTGGGTAGA R_TTCAGAGAGAGGATGGTATAGAG 285-300 2 0.36 2 0.36 0.58
BhUNICAMP070 KM068305 (GT)9 65 F_CCCCGGTCTCGACCTATC R_GAGGCTGCCCCCTTACTC 174-214 12 0.84 6 0.78 0.54
BhUNICAMP071 KM068306 (AC)11 65 F_CGCAACGAAGCTCCAATAG R_CGATCGCAAGCGTGTATCTA 160-228 11 0.86 11 0.86 0.94
BhUNICAMP072 KM068307 (GT)7 56.5 F_CCCCATGTAAACAACCGTAGA R_CCATGGTTGACCGCTAGAA 174-186 3 0.56 3 0.56 0.85
BhUNICAMP073 KM068308 (TG)10 60 F_TGAACATGTGAATGCCCACT R_ATTGCAGGATGCGGACTCTA 240-304 10 0.85 10 0.85 0.94
BhUNICAMP074 KM068309 (CT)6 58.5 F_ACGAACGATCCGACCAACTA R_TGCTTACGAGACGGCATAGA 231-255 7 0.81 7 0.81 0.92
BhUNICAMP075 KM068310 (TC)22 50 F_TGAATGCTTTTGTCCTGGTATC R_ACGTGCAGCAGCAACAGTA 148-236 28 0.95 24 0.95 0.98
BhUNICAMP076 KM068311 (AC)18 51.5 F_CCGATGGTCAAAGGTCAGTT R_GGTGGGCATATACCATGTTT 206-234 10 0.84 10 0.84 0.66
BhUNICAMP077 KM068312 (AC)7 65 F_CGGGAAGTCCTACTCCGTAA R_GGAGCTCAAGGTAGGGATTG 212-230 8 0.83 8 0.83 0.93
BhUNICAMP078 KM068313 (GT)7 58.5 F_ACCAGTGCACGTCTGAAAGA R_CGATCACTGCTGCGTCATA 216-218 2 0.35 2 0.35 0.52
BhUNICAMP079 KM068314 (AG)12G(GA)17 62.5 F_GGATTGAAAGTTGGAGCACA R_GCATGCTGTGAAGGAGGTTA 180-222 17 0.92 17 0.92 0.96
BhUNICAMP080 KM068315 (GA)26 50 F_CAAGCCTCTTCATGCAAGTAAC R_TGTCATACCCCCATGATTAAGA 176-230 22 0.93 21 0.93 0.93
BhUNICAMP081 KM068316 (AGC)5ACAAT(CA)11 55 F_CTGGCATGGGTCCCTTTAC R_TCTTCTTCCTCCAGCCACAT 160-179 5 0.75 5 0.75 0.95
BhUNICAMP082 KM068317 (CA)23 60 F_TTGCCGGGAACAGTTATACA R_GAAGCTCTATCAAACAGCCCT 157-192 9 0.82 9 0.82 0.92
BhUNICAMP083 KM068318 (AG)22 56.5 F_AAACATGCACCGTCATAACT R_GGGCTTGATTCATTTGTTA 152-190 6 0.68 4 0.68 0.77
BhUNICAMP084 KM068319 (TG)15 65 F_GGCGAAGACCATACCCTGTA R_TGCTGGTGGAAGAAGATGAA 159-182 9 0.80 9 0.80 0.96
BhUNICAMP085 KM068320 (GT)9 60 F_CGATTTATCGACGACCGAGT R_CCTTACTCGCAGGTCTGTCC 158-171 5 0.76 5 0.76 0.64
BhUNICAMP086 KM068321 (TC)19 65 F_AGTTGAATGGGCTGAACCAT R_TGCACTTCCAGGATCAGACA 238-326 10 0.82 10 0.82 0.93
BhUNICAMP087 KM068322 (GT)10 50 F_GGCCATTTCTAGCCAAACAA R_CCTTACTCGCAGGTCTGTCC 240 1 0.00 1 0.00 0.00
BhUNICAMP088 KM068323 (TG)12 65 F_AGAGGTTCCATGGACATTGC R_CTCATCAACAGACGCCTGAA 178 1 0.00 1 0.00 0.00
BhUNICAMP089 KM068324 (AC)7 65 F_CCGGATAGAAGGTCTGAACG R_AGTCGTCGAAGCGAGCTCTA 175 1 0.00 1 0.00 0.00
BhUNICAMP090 KM068325 (CA)10 65 F_CAGAGTAAGCTTCCGGGACA R_CGATTTATCGACGACCGAGT 200-300 12 0.85 11 0.85 0.91
BhUNICAMP091 KM068326 (AC)8 65 F_CTTGTGCCACTTCCACCTTT R_TCGTGTGGACACTTCCTCTG 120-150 9 0.83 9 0.83 0.95
BhUNICAMP092 KM068327 (TG)6 65 F_ATGCCTTGCTCCCACTAACA R_TAAATGCTCCAGCGACCTTC 135-168 11 0.85 11 0.85 0.91
BhUNICAMP093 KM068328 (AAG)4 65 F_GGAGCGCTAATTTCGTTCAG R_CCTCCGTTCTCGCTAATGAC 230 1 0.00 1 0.00 0.00
BhUNICAMP094 KM068329 (TG)7 65 F_TTGGAGCTTTCCCTAGCTCA R_GAACAAGAAGGGAGGAAGCA 272-290 4 0.31 4 0.31 0.39
BhUNICAMP095 KM068330 (TC)16(TG)14 65 F_GGGTTGGCCTACACACTGAT R_CGCACGACATTGATACCTTG 268-320 6 0.75 6 0.75 0.92
BhUNICAMP096 KM068331 (TC)8TT(TC)40 65 F_TGTTCTGCTCACTGGTTTGG R_TCAGCTCTCTACGGCTGGAT 157-255 11 0.87 11 0.87 0.95
BhUNICAMP097 KM068332 (GT)6 65 F_GCGAGCTACCGAGGTATTTG R_ACGTCAATGTCGAGCTTCCT 129-148 5 0.69 5 0.69 0.80
BhUNICAMP098 KM068333 (GT)10(G)18 65 F_GGACTGGTCGTCTTTCCATC R_GCTTTCTGCAAGCGGTAGAT 250-312 9 0.85 9 0.85 0.95
BhUNICAMP099 KM068334 (CA)10TG(GA)10 65 F_TTTGTGGCACCTGCAGAATA R_CGCTTCGTGCTGACAGATTA 124-174 16 0.91 16 0.91 0.99
BhUNICAMP100 KM068335 (TG)12 65 F_GCGCCATGGTTTCATCTATT R_GGTGGTTCCTCGTGTGAGAT 178-219 7 0.79 7 0.79 0.98
BhUNICAMP101 KM068336 (TG)28 65 F_GGTAAAGAAGGGCCGGACT R_GCATGGCATGTTCCTACTGA 128-184 14 0.89 12 0.89 0.97
BhUNICAMP102 KM068337 (GCGA)4 65 F_TGGTGGGCTCCACTATCTCT R_TCCGCCATCTCTCCTCTCT 224-260 12 0.89 12 0.89 0.94
BhUNICAMP103 KM068338 (CT)22 65 F_AGCTCTCCCGCCTCTCTCT R_CATCCACACCGTCTCTCTCA 100-156 14 0.91 14 0.91 0.96
BhUNICAMP104 KM068339 (TG)26 60 F_ACGACGACCTAATGGGTGAA R_ACCCAGCAACAAATCTCGTC 190-274 15 0.87 13 0.87 0.96
BhUNICAMP105 KM068340 (AC)10ATACACACACAC(AG)53 50 F_CTCCATCACGTGCTTGCTAA R_GTGTGATCGGCTGGAGATTT 100-176 30 0.93 29 0.93 0.98
BhUNICAMP106 KM068341 (TTTGT)3 50 F_GCTGTTCGGAGAGGAATCTG R_ATGAGAGGAGGGAAGGAAGG 135-155 8 0.79 7 0.79 0.91
BhUNICAMP107 KM068342 (GA)18 50 F_GGGTCAGTGTCGTCTCAGTTT R_CAGATTCCTCTCCGAACAGC 118-190 26 0.94 26 0.94 0.98
BhUNICAMP108 KM068343 (CT)16 65 F_TTGCCATTACTGGATCTGGA R_GCGCCACCCATAACTTAAA 112-160 14 0.85 13 0.85 0.94
BhUNICAMP109 KM068344 (GT)9 60 F_AGCGAGTCAAGCACAAGGAT R_GGGTCCAATCTCCCTCTCTC 186-226 9 0.82 9 0.82 0.93
BhUNICAMP110 KM068345 (TG)8 65 F_TCTGCATCCACTAGGCTCAG R_TCCTCCACCTTCTTTCCGTA 148-164 4 0.39 4 0.39 0.46
BhUNICAMP111 KM068346 (TG)27 65 F_AACTCCGACTATCTTCCAGTTGA R_AATGCATGGGTAGGATCTGC 250-330 15 0.89 15 0.89 0.96
BhUNICAMP112 KM068347 (AC)26 65 F_GACCAAACCCTCCGAAGTTA R_GGTTGCAACTACACGACCAG 246-300 10 0.81 10 0.81 0.94
BhUNICAMP113 KM068348 (CGTG)3 63 F_AACTTCGAGAGGTTCGTCCA R_ACCGGCAATCTATCCGTGT 144-179 3 0.45 3 0.45 0.51
BhUNICAMP114 KM068349 (CT)21 63 F_TATACAAGGCGCATCCACAA R_GCTCTTTCCTCACGCTGTTC 200-266 15 0.89 15 0.89 0.96
BhUNICAMP115 KM068350 (AC)27(AT)7 60 F_CTTCCTGCCAATAAGCGAAG R_CGAGCTTCCAGATTCTTTGG 240 1 0.00 1 0.00 0.00
BhUNICAMP116 KM068351 (TG)8 65 F_CTCCGCACCGCTTAAATTAG R_GTTGGAAATGGTGCTTCCAC 288-306 3 0.52 3 0.52 0.62
BhUNICAMP117 KM068352 (TGA)7 65 F_CCAACTGAACGGCCATACTT R_CCCACAAAGGAACCCTGAT 290-300 4 0.61 4 0.61 0.77
BhUNICAMP118 KM068353 (AG)9 50 F_CTGCATAACTTTCAGCCATCTC R_TTGGCACAACTGGAACGTAG 149 1 0.00 1 0.00 0.00
BhUNICAMP119 KM068354 (AAG)7 65 F_AAGGGCGTGATGTTCTGAAG R_AGGCCAAACGAATTTCTCAA 189-204 4 0.66 4 0.66 0.82
BhUNICAMP120 KM068355 (AT)8ACACACACACG(CA)9 65 F_TCCAGCAGTGTGTTCCTCAG R_ACCAGGAGTGCATAGCCAAG 190-200 6 0.71 6 0.71 0.75
BhUNICAMP121 KM068356 (TC)12 65 F_CGCTACTGCTGCACACAAAT R_CTGAGTGCGCCGTATGTTTA 170-195 6 0.71 6 0.71 0.92
BhUNICAMP122 KM068357 (GT)15 65 F_AGGAAGGCTCGCACTCACTA R_CCAAAGGCGGTGGTTAGATA 200-315 14 0.90 14 0.90 0.95
BhUNICAMP123 KM068358 (TTA)4 65 F_CCAAACTCTAGCTTTCACAGCA R_TTGGATCCACGTCAAACAAG 280 1 0.00 1 0.00 0.00
BhUNICAMP124 KM068359 (AG)23 65 F_TTGGAGTTGCTGGGCTATTT R_GAACCAAGCATAAGGCAACA 218-320 12 0.85 10 0.85 0.95
BhUNICAMP125 KM068360 (GT)8GAATGTGTGT(GA)7 65 F_TGTTATCAGTGCAGGTGTTGG R_GAGGCTGACGAAAGCTCAAC 258-280 7 0.81 7 0.81 0.93
BhUNICAMP126 KM068361 (AC)10 65 F_GGGAACCCAGGGTATCGTAT R_CTCTCCCAGCGTCTTTCCTT 210 1 0.00 1 0.00 0.00
BhUNICAMP127 KM068362 (GT)6 65 F_CCACCATTGCTTCCAGAGTAA R_ATTCGCCTCTCCTAGCACAA 272-320 7 0.69 7 0.69 0.91
BhUNICAMP128 KM068363 (GA)37 65 F_TGCCTGGAGACTGAGAAAGG R_CCTGCAGCAGACCTTCACAT 150-240 17 0.91 17 0.91 0.98
BhUNICAMP129 KM068364 (AC)7ATGAA(CATG)3(CA)22 63 F_TGTGTTTAGACCGCCAACAA R_TTATCGGCTCCCATTCACTC 207-310 11 0.84 10 0.84 0.95
BhUNICAMP130 KM068365 (AC)7 63 F_ACGCAGGAGAACTGCGTATC R_ATGGGATCCAACCGAACATA 236-300 12 0.79 11 0.79 0.87
BhUNICAMP131 KM068366 (AC)7(A)16 60 F_CATCAGATGCCTCAAACAGC R_GCAGGTGTGCAGCAAATAGA 184-238 14 0.87 14 0.87 0.93
BhUNICAMP132 KM068367 (TG)7(T)29 50 F_TCACTAGTGCGTCTGCTGCT R_GCACTCCATTGCAGACCTAAG 184-196 4 0.53 3 0.53 0.63
BhUNICAMP133 KM068368 (TG)10 50 F_CATGACTTATGTCCTTGGTGGA R_TCGACAGTGGAGCCACAA 114-162 19 0.89 16 0.89 0.97
BhUNICAMP134 KM068369 (CCGG)3 60 F_CAAACGGAGGAAGAGAGACG R_GGTGTCAATGCAGCCAAGTA 114-135 9 0.75 5 0.75 0.83
BhUNICAMP135 KM068370 (AG)27 65 F_CATGAGCCATCTCGTTGTTG R_TGCATTGACTTGACGTCTCC 176-260 14 0.90 9 0.90 0.91
BhUNICAMP136 KM068371 (AC)9(ACAA)3 50 F_TCCTGGTAAAGTTCCTCGTCA R_ACAACAATGCACGTCGAGAA 225-290 7 0.75 6 0.75 0.93
BhUNICAMP137 KM068372 (GA)23 65 F_TAGGTTTGGGTGGCACTAGG R_CTCCATGCTGCGTTGCTAT 258-320 11 0.85 9 0.85 0.91
BhUNICAMP138 KM068373 (T)12 60 F_TGCTCATGTGGGTCACATTT R_TGTGTGCCTGTGTGATGCTA 270-288 5 0.70 5 0.70 0.95
BhUNICAMP139 KM068374 (AAAAG)3 65 F_TCCTTTCTTTGAGCCGAGAG R_GCTGATGCTGACATCAAGGA 248-294 6 0.67 5 0.67 0.97
Total average       10.26 0.77 9.60 0.77 0.87
Lb-1 average       11.05 0.79 10.48 0.79 0.87
Lb-2 average       9.18 0.75 8.40 0.75 0.86
  1. *Species evaluated: Urochloa humidicola (Rendle) Morrone & Zuloaga, Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster, Urochloa decumbens (Stapf) R.D. Webster, Urochloa dictyoneura (Figure & De Not.) Veldkamp, Urochloa ruziziensis (R. Germ. & C.M. Evrard) Crins.
  2. **Hybrids included.
  3. aAmplification temperature (°C).
  4. bMaximum number of alleles observed.
  5. cPolymorphism Information Content.
  6. dDiscrimination Power.