Table 1 Oligonucleotide primers used in this study
From: Potential complications when developing gene deletion clones in Xylella fastidiosa
Primer name | Primer sequence 5’ - 3’ | Function | Reference |
|---|---|---|---|
pilJA | ACCTGACTGTTCATCTGATGCG | Deletion of the pilJ gene and confirmation of deletion | This publication |
pilJB | TTCGGCGCGCCGAATCTAAATATGC | Deletion of the pilJ gene | This publication |
AAGACGGGACCG | |||
pilJC | TTCGGCGCGCCGAAATGCTTCTCGG | Deletion of the pilJ gene | This publication |
CTTGGAAAGGA | |||
pilJD | CGCAGCACGGATCTCGTTAA | Deletion of the pilJ gene and confirmation of deletion | This publication |
pilJE | CCCGAGTACCAACTTTTGGATTG | Amplification of pilJ gene fragment | This publication |
pilJF | ATCTGCTCATCCTTTCCAAGCC | Amplification of pilJ gene fragment | This publication |
RST31 | GCGTTAATTTTCGAAGTGATTCGAT TGC | Xylella fastidiosa detection | [17] |
RST33 | CACCATTCGTATCCCGGTG | Xylella fastidiosa detection | [17] |