Skip to main content

Table 1 Characteristics for 15 polymorphic microsatellites in the African Buff-spotted Woodpecker Campethera nivosa

From: Isolation and development of microsatellite loci in an African Woodpecker (Campethera nivosa) using polymerase chain reaction and DNA sequencing

Locus Primer sequence (5′–3′) Primer labeling Repeat motif Ta (°C) n HWE Ho He PID GenBank accession no.
CNI 3* F: TGTAAAACGACGGCCAGTAAAGACATCCATTGCCCTTG 6-FAM (AGACT)12 59 15 <0.0001 7 0.25 0.747 9.6E−02 KP636532
CNI 6 F: TGTAAAACGACGGCCAGTGCAAAAGGTGGTATTGGAAGA VIC (AC)6 60 15 0.3507 4 0.667 0.705 1.4E−01 KP418967
CNI 7 F: TGTAAAACGACGGCCAGTATTTTCCCCCGTCTCTGATT 6-FAM (TG)6 54 15 0.0072 4 0.273 0.624 1.9E−01 KP418968
CNI 8* F: TGTAAAACGACGGCCAGTTGGATGATAGGTTGGACGTG VIC (CTATT)10 59 15 <0.0001 8 0.444 0.852 3.9E−02 KP636533
CNI 9 F: TGTAAAACGACGGCCAGTCCTCCTCTAACACCACACCA VIC (CA)10 59 15 0.0188 12 0.75 0.889 2.2E−02 KP418969
CNI 11 F: TGTAAAACGACGGCCAGTTGGCTCCACACTGAGTTGTC VIC (AATAG)12 60 15 0.4846 10 0.917 0.847 4.0E−02 KP418970
CNI 13 F: TGTAAAACGACGGCCAGTTTCCAACCTGGTCAATTCAA VIC (CTATT)11, (CTACT)10 57 15 0.005 13 0.636 0.901 1.8E−02 KP418972
CNI 15 F: TGTAAAACGACGGCCAGTTCTTCCTAGGGCCTGTCACT NED (TCTA)7 59 15 0.0034 10 0.667 0.84 4.4E−02 KP418973
CNI 18 F: TGTAAAACGACGGCCAGTTGGAAGACTGGGACCAAAAC VIC (CTAT)12 59 15 0.7442 8 0.833 0.785 7.1E−02 KP418976
  1. Ta optimized annealing temperature, n number of individuals genotyped, k number of alleles, Ho observed heterozygosity, He expected heterozygosity, HWE p values from heterozygote deficit tests, PID probability of identity.
  2. * Departure from Hardy–Weinberg equilibrium (in terms of heterozygote deficit) following Bonferroni correction. CNI1 exhibited heterozygote excess (p = 0.01).