Skip to main content

Advertisement

Table 1 Characteristics for 15 polymorphic microsatellites in the African Buff-spotted Woodpecker Campethera nivosa

From: Isolation and development of microsatellite loci in an African Woodpecker (Campethera nivosa) using polymerase chain reaction and DNA sequencing

Locus Primer sequence (5′–3′) Primer labeling Repeat motif Ta (°C) n HWE Ho He PID GenBank accession no.
CNI 1* F: TGTAAAACGACGGCCAGTGGTGGTGGAGTCACCTTCAT VIC (GTATT)7 60 15 1 3 0.917 0.531 3.2E−01 KP418965
  R: GTGTCTTCCTTTACTTGCCCTTCTTGC           
CNI 2* F: TGTAAAACGACGGCCAGTCCCCTCTTGGAAGTGTTCAA VIC (AAAC)5 60 15 <0.0001 5 0.1 0.485 2.9E−01 KP636531
  R: GTGTCTTGGGGGAGTTTGACTCAAGTG           
CNI 3* F: TGTAAAACGACGGCCAGTAAAGACATCCATTGCCCTTG 6-FAM (AGACT)12 59 15 <0.0001 7 0.25 0.747 9.6E−02 KP636532
  R: GTGTCTTTCTTCCAACCTGGTCTGGTC           
CNI 4 F: TGTAAAACGACGGCCAGTAGACTGGATGGGACACTTGG VIC (ATTTCT)11 50 15 0.7509 8 0.818 0.752 9.2E−02 KP418966
  R: GTGTCTTAGTGGCACCTCCTGAGACAT           
CNI 6 F: TGTAAAACGACGGCCAGTGCAAAAGGTGGTATTGGAAGA VIC (AC)6 60 15 0.3507 4 0.667 0.705 1.4E−01 KP418967
  R: GTGTCTTTGTGTGCTGGAATAGGCAAG           
CNI 7 F: TGTAAAACGACGGCCAGTATTTTCCCCCGTCTCTGATT 6-FAM (TG)6 54 15 0.0072 4 0.273 0.624 1.9E−01 KP418968
  R: GTGTCTTCAAACGAACATCACCACCAC           
CNI 8* F: TGTAAAACGACGGCCAGTTGGATGATAGGTTGGACGTG VIC (CTATT)10 59 15 <0.0001 8 0.444 0.852 3.9E−02 KP636533
  R: GTGTCTTGCCCATCAACAGAAAGCAGT           
CNI 9 F: TGTAAAACGACGGCCAGTCCTCCTCTAACACCACACCA VIC (CA)10 59 15 0.0188 12 0.75 0.889 2.2E−02 KP418969
  R: GTGTCTTGACCAGGCCAGTGGATTTTA           
CNI 11 F: TGTAAAACGACGGCCAGTTGGCTCCACACTGAGTTGTC VIC (AATAG)12 60 15 0.4846 10 0.917 0.847 4.0E−02 KP418970
  R: GTGTCTTCGAAGGTCTCTTCCAACCTG           
CNI 12 F: TGTAAAACGACGGCCAGTACAGCCTCTCCCATTGTCTC NED (AGAAT)5 50 15 0.0482 3 0.455 0.632 2.1E−01 KP418971
  R: GTGTCTTGCTTGGTGCCATGGTTTAGT           
CNI 13 F: TGTAAAACGACGGCCAGTTTCCAACCTGGTCAATTCAA VIC (CTATT)11, (CTACT)10 57 15 0.005 13 0.636 0.901 1.8E−02 KP418972
  R: GTGTCTTGGCATGCCTAGCTTTGGATA           
CNI 15 F: TGTAAAACGACGGCCAGTTCTTCCTAGGGCCTGTCACT NED (TCTA)7 59 15 0.0034 10 0.667 0.84 4.4E−02 KP418973
  R: GTGTCTTTCCACTTGAAAGGAAAGAGGTC           
CNI 16 F: TGTAAAACGACGGCCAGTTTTGACCAAGGAGGGAAAAA NED (GATA)8 59 15 0.9271 7 0.75 0.698 1.2E−01 KP418974
  R: GTGTCTTCAGGGGATTATAGGGGATGG           
CNI 17 F: TGTAAAACGACGGCCAGTTGGAAGACTGGGACCAAAAC NED (ATCT)12 59 15 0.398 10 1 0.865 3.3E−02 KP418975
  R: GTGTCTTGAATAATCACAATTGTTAATCTGCAT           
CNI 18 F: TGTAAAACGACGGCCAGTTGGAAGACTGGGACCAAAAC VIC (CTAT)12 59 15 0.7442 8 0.833 0.785 7.1E−02 KP418976
  R: GTGTCTTGAATAATCACAATTGTTAATCTGCAT           
  1. Ta optimized annealing temperature, n number of individuals genotyped, k number of alleles, Ho observed heterozygosity, He expected heterozygosity, HWE p values from heterozygote deficit tests, PID probability of identity.
  2. * Departure from Hardy–Weinberg equilibrium (in terms of heterozygote deficit) following Bonferroni correction. CNI1 exhibited heterozygote excess (p = 0.01).