Skip to main content

Table 1 Primer sequences

From: Evolutionary dynamics of rhomboid proteases in Streptomycetes

Gene identifier Primer sequence Fragment size (bp)
SCO3855 family A GCTACCTCGCCCTCTACCTC
GGGTGAAGGTGAAGATCAGG
206
SCO2013 family B GATGAACATGGTCGTGCTGT
GGCCATGAAACGGTTGAC
241
SCO6038 family C GCTCTTCCTGTGGATCTTCG
CCTCGGATACAGCACCAGAT
196
SCO2139 family D CTGCCCTTCCTCTTCTTCCT
ACGCCACCAACTCTAGTCGT
197
\