Skip to main content

Table 7 Primers used in this work

From: Identification of putative adhesins of Actinobacillus suis and their homologues in other members of the family Pasteurellaceae

Primer name Class Locus tag Sequence Source
ASU2-ycgV-F1 Autotransporter ASU2_07665 CTGGGATGTTCCTGTTGTTGCT This work
ASU2-ycgV-R1 TTTACCGAGGTTTATCGTACTGTTTGT This work
ASU2-flp1-F1 Fimbriae-associated ASU2_04295 CTGTAACTGAAGGTATCCGCAACT This work
ASU2-flp1-R1 TGCTAAAGCCACAGCAATTAAACC This work
ASU2-tadG-F1 Fimbriae-associated ASU2_04360 ACTGAATGACGACAAGAATACATCG This work
ASU2-tadG-R1 GCAGAGTAGTAGTTTCCATCACCT This work
ASU2-pilA-F1 Fimbriae-associated ASU2_05045 ACTGTTAGCGGCATCTTCTGC This work
ASU2-pilA-R1 CTACGCTGCCCTTGCCATTC This work
ASU2-ompP2-F1 OMP ASU2_00030 ACCTCAGCCAAAGACACTTACCAAA This work
ASU2-ompP2-R1 TAAACGCCATTCTACACGGCCTAAA This work
ASU2-ompA-F1 OMP ASU2_09940 CGGTAAAGTAGGTGTTGCAGTT This work
ASU2-ompA-R1 ATTTCTCTGTTGGTTCGTTAGTGT This work
ASU2-plp4-F1 OMP ASU2_11270 GTCGAATCTAACTGCGAAGGGTAAAG This work
ASU2-plp4-R1 GTTGTATGCAGGAGAACCTAAACGG This work
ASU2-fhaB-F1 Miscellaneous ASU2_06635 GGATTTAGCCGTACATGGAAATGG This work
ASU2-fhaB-R1 ATACTTTACCTTTGATTTGAGCCGT This work
ASU2-ftpA-F1 Miscellaneous ASU2_09130 CGGAGCGTATGGCAGCATTAG This work
ASU2-ftpA-R1 GGATATTCAGGCGTTTGACGTGTT This work
ASU2-comE1-F1 Miscellaneous ASU2_10345 GTCACAGAACCCACTCCCGT This work
ASU2-comE1-R1 TTTATCTTGGATTTCCGCTGCTGTT This work