Skip to main content

Advertisement

Table 3 Primers used for the determination of virulence factor gene expression in S. suis P1/7

From: Hyaluronate lyase activity of Streptococcus suis serotype 2 and modulatory effects of hyaluronic acid on the bacterium’s virulence properties

Gene Primer sequence (5′–3′) Expected amplicon size (bp)
16S rRNA Forward: TAGGGTTTCTCTTCGGAGCATCG Reverse: AACTGAATGATGGCAACT 123
cps2J Forward: AGAGTGTTTAGATAGCATTATTTCC Reverse: TAATTTGCTGTGCTATTTTTGATAC 198
mrp Forward: TATCAGATTAATACAACTCGTTACG Reverse: ATATTGTACTGTATCCTTTTGAACC 216
epf Forward: CTAAACGTAACTTGGAATTTGTAAG Reverse: AGCCATAAGTAAGATTATTTGATCC 162
sly Forward: TTGAATATTGACATGAAGATTGCGA Reverse: AAGCTGGAGAAGTTTGGGAACC 97
ssnA Forward: GCTGACTATCGCTTCTTATAACATT Reverse: GTCGATTCGGCCTAGGCTGAGATTG 390