Skip to main content

Table 3 Primers used for the determination of virulence factor gene expression in S. suis P1/7

From: Hyaluronate lyase activity of Streptococcus suis serotype 2 and modulatory effects of hyaluronic acid on the bacterium’s virulence properties

Gene Primer sequence (5′–3′) Expected amplicon size (bp)
16S rRNA Forward: TAGGGTTTCTCTTCGGAGCATCG
Reverse: AACTGAATGATGGCAACT
123
cps2J Forward: AGAGTGTTTAGATAGCATTATTTCC
Reverse: TAATTTGCTGTGCTATTTTTGATAC
198
mrp Forward: TATCAGATTAATACAACTCGTTACG
Reverse: ATATTGTACTGTATCCTTTTGAACC
216
epf Forward: CTAAACGTAACTTGGAATTTGTAAG
Reverse: AGCCATAAGTAAGATTATTTGATCC
162
sly Forward: TTGAATATTGACATGAAGATTGCGA
Reverse: AAGCTGGAGAAGTTTGGGAACC
97
ssnA Forward: GCTGACTATCGCTTCTTATAACATT
Reverse: GTCGATTCGGCCTAGGCTGAGATTG
390