Skip to main content

Table 1 Global characterization of the 22 microsatellite loci characterized in Acanthodactylus aureus, A. dumerili/A. senegalensis and A. longipes

From: Development and characterization of polymorphic microsatellite loci for spiny-footed lizards, Acanthodactylus scutellatus group (Reptilia, Lacertidae) from arid regions

Locus GenBank assess no. Repeat Primer sequence (5′–3′) Multiplex TD Dye
Ac1 KU295182 (ATAC)8 F: CTGTGGTATATCCCCTGCCA
R: GGTGGCTTCTCCACAGCTATT
1 58°/54° FAM
Ac4 KU295183 (TTC)21 F: ACAGCTCTGCAGTAATTCCATTT
R: CCGATGCAGTGTTTCGTAGG
3 58°/54° VIC
Ac5 KU295184 (AAC)15 F: GTTGCTTCAACTGCTCCTCC
R: AGTGTCCTGTGCACAACCAG
1 58°/54º VIC
Ac6 KU295185 (TTG)10 F: GTAGCCCAGTCAGATGGGTG
R: CCTCCAACATTCCAGTCCAG
4 55°/51° NED
Ac8 KU295186 (TTG)11 F: GACATCTGAAGGCAGCCCTA
R: GGTTGTAGCCTGGAGCAGAA
1 58°/54° NED
Ac9 KU295187 (CAA)15 F: TCATACAGGGATGTTTCAGGG
R: GCAGGAGGAAGGAAGCTTTT
1 58°/54° PET
Ac13 KU295188 (AAC)14 F: TCCATGGGGTCACAAAGAGT
R: TCTCCAGCACTTATCTGATGC
2 58°/54° FAM
Ac14 KU295189 (CAA)10 F: TTAAGTGGCAATGTGTTGCAT
R: TCCCACATGGTGGGTTACTT
2 58°/54° VIC
Ac16 KU295190 (AGG)10 F: AGTCAATTTATTCAAATGATCTTCCA
R: TCATCCAAGAAAATCTGCTGC
2 58°/54° VIC
Ac19 KU295191 (AAC)14 F: TCATTTCACTTCAAACCTGTGG
R: ACTGATGTTGGGTTTGGAGC
2 58°/54° PET
Ac20 KU295192 (GTT)11 F: ATGCATAAGTACGAAAAGGGGA
R: TCTACAGAGAAAGAGAAATAACAACAA
2 58°/54° PET
Ac23 KU295193 (CAT)8 F: GCGAACATGCACAAGGTTT
R: ACCCTGCTTGGTTCTCATTG
1 58°/54° FAM
Ac28 KU295194 (ACAT)8 F: TGTCCGAAATAGGATGGAGC
R: GGAAAGCCAATGCCTCTACA
4 55°/51° PET
Ac31 KU295195 (GTT)10 F: GAAGGGTTACAACTGCCTGG
R: CAGTGCTTCAGCAACAGGAG
4 55°/51° FAM
Ac32 KU295196 (TTC)15 F: TAGTCCGTAAACTTGTGGGTCA
R: TTCTCAGACAACAGACACCCA
3 58°/54° FAM
Ac33 KU295197 (TGT)16 F: GGCACTGAAATATGTGGTTTTG
R: TGACATGCTTCGGTGAAGTC
3 58°/54° FAM
Ac36 KU295198 (TGT)9 F: GTCACGTTGATTGCATTGCT
R: GCCAACTGGGAAACCTAGC
3 58°/54° VIC
Ac43 KU295199 (CAA)13 F: AGCTTTTGTACGTTCCTTTGC
R: CCAGAGAAACACATATGCAAGC
4 55°/51° FAM
Ac44 KU295200 (GGA)11 F: TCCTTAAGAAAGGTACTTAATGCCA
R: TCTTTACGTAGTCCCTTTGTGG
4 55°/51° VIC
Ac45 KU295201 (CAA)10 F: AGGCAATGGAAGACAGGGA
R: GCCTACAGTTTGTGCATAGGG
4 55°/51° VIC
Ac47 KU295202 (ACA)11 F: CTTGCCTCTTCGCTTTCTGT
R: TCCGGACAGCATTCCTCTAC
4 55°/51° NED
Ac49 KU295203 (AAC)11 F: CAAAGAAAATTGTTGGAGGGG
R: GTAAAACATCGGAAGGCAGC
4 55°/51° PET
  1. TD touchdown temperatures