Skip to main content

Table 1 General information of the primers for qPCR analyzes

From: Carbon dioxide receptor genes and their expression profile in Diabrotica virgifera virgifera

Gene name Primer Sequence (5′–3′) Amplicon (bp) E (%) R2
Dvv_Gr1 Forward: GTGGCACAGCATTGCTTA 221 94 0.970
Reverse: CTATACGCCCTGCCCAAC
Dvv_Gr2 Forward: GAACTAAGCGAGCTCCTCCA 192 108.8 0.989
Reverse: CAGAAGCACCATGCAATACG
Dvv_Gr3 Forward: CTGGATGAATGACCATGCAC 184 104.6 0.992
Reverse: ATCCTCGGGGATGCTTATCT
  1. E amplification efficiency, R 2 correlation coefficients