Skip to main content

Table 1 Candidate reference genes for microRNA normalisation

From: Identification of valid reference genes for microRNA expression studies in a hepatitis B virus replicating liver cell line

microRNA Sequence PubMed ID
miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 18375788
miR-24-3p UGGCUCAGUUCAGCAGGAACAG 22074795
miR-26b-5p UUCAAGUAAUUCAGGAUAGGU 18718003
miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG 22134529
18375788
miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA 22134529
21519184
18375788
miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG 18375788
22788411
miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU 20890088
miR-151a-5p UCGAGGAGCUCACAGUCUAGU 22745731
miR-191-5p CAACGGAAUCCCAAAAGCAGCUG 22134529
21519184
18375788
miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 21567136
miR-425-5p AAUGACACGAUCACUCCCGUUGA 20429937
miR-940 AAGGCAGGGCCCCCGCUCCCC 24488924
let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 24223986