Skip to main content

Table 2 List of Kompetitive Allele-Specific PCR (KASPar) single-nucleotide polymorphism (SNP) markers and their sequences used to genotype 1600 F2 progeny derived from a cross of Arina (Qsng-sfr-3BS) by two F2 progeny from a cross between Alsen and Ocoroni86 that were homozygous for the molecular markers linked to the Fhb1 (Alsen) and Sr2 (Ocoroni86) resistance genes

From: Determining the order of resistance genes against Stagonospora nodorum blotch, Fusarium head blight and stem rust on wheat chromosome arm 3BS

Primer namea Sequence Fluorescent label
Xsnp3BS-2_ALA GAAGGTGACCAAGTTCATGCTGGTCTCGGAATTGATTGTAGAAGGTA FAM
Xsnp3BS-2_ALC GAAGGTCGGAGTCAACGGATTGTCTCGGAATTGATTGTAGAAGGTC VIC
Xsnp3BS-2_C1 CCAGAGACTACATAKCCTTTTCTTACAAT  
Xsnp3BS-3_ALG GAAGGTGACCAAGTTCATGCTTTCAAGTGCTGGCATTGCATCC FAM
Xsnp3BS-3_ALA GAAGGTCGGAGTCAACGGATTCTTTCAAGTGCTGGCATTGCATCT VIC
Xsnp3BS-3_C1 GCTTCTTYGCACCTCTAGTGCCAA  
Xsnp3BS-9_ALC GAAGGTGACCAAGTTCATGCTTTCAAGAAAGCTTCTGCCAGTCAC FAM
Xsnp3BS-9_ALG GAAGGTCGGAGTCAACGGATTTCAAGAAAGCTTCTGCCAGTCAG VIC
Xsnp3BS-9_C1 AAAAGAACAGACACGCCAGGATTCAAAA  
g01130_AL1 GAAGGTGACCAAGTTCATGCTATAGCTYCATCTCATTTCCTCCTTG FAM
g01130_AL2 GAAGGTCGGAGTCAACGGATTCATAGCTYCATCTCATTTCCTCCTTA VIC
g01130_C1 TAGAACCAAAGCKTCAAACATTTCTGTGAA  
  1. aPrimer name indicates the published markers from which the sequences were obtained for design of the KASP assay, with the addition of the allele-specific designation. The common primer is indicated as C1