Skip to main content

Table 1 Characterization of 30 EST-SSRs in the Chinese mitten crab Eriocheir sinensis

From: Identification and characterization of thirty novel microsatellite DNA markers from the Chinese mitten crab Eriocheir sinensis expressed sequence tags

Locus GenBank accession no. Repeat motif Primer sequence (5′–3′) T a (°C) No. of individuals No. of alleles Size range (bp) H O H E P value
ES27 FL571941 (GT)11 F: TGTGATGAGAAGAAACCAAAGA 52 59 8 107–123 0.712 0.797 0.0005*
R: AATACCTGCTGGCGATGA
ES39 FG359711 (GT)17 F: AGGACGAAAGTTGGAGGG 55 56 8 114–128 0.482 0.864 0.0000*
R: AAATACAAATCTACGGGAGACAC
ES104 FL569100 (TG)21 F: TCACAACTACGAAAACCT 48 53 3 190–200 0.047 0.047 1.0000
R: GAGTGTCAGTGTATGGAAT
ES108 FG984086 (GT)19 F: GTAAACCCTACGAAACCATA 54 59 15 91–119 0.932 0.932 0.0000*
R: ACTCCCTAAACTACCTAACTACCA
ES130 FL570152 (GGC)7 F: CGTTCGTTGTGAGCGTCTGC 57 60 4 145–154 0.167 0.159 1.0000
R: CGCCTGGTCCATCTCATCG
ES212 FG984116 (CCA)6(CAA)10 F: GTGACACTGATGCCTGACGA 55 56 4 181–190 0.482 0.583 0.2114
R: TTATGCCTTTATTGACCGAGAC
ES271 FG359821 (TG)12 F: GCTTCTCACCCGTGATGT 54 49 6 176–186 0.615 0.754 0.0065
R: CTCCTCCTTTGCTTTCTTTA
ES352 FL572494 (GT)10 F: CACTCGGTACAAACATCAC 53 56 17 91–127 0.768 0.929 0.0000*
R: AATGGGTATGGATTTAGTGT
ES582 FL570362 (GA)26 F: ACCTCCAAGCCCCTTACC 53 58 5 241–261 0.293 0.296 0.6958
R: GAACAAACACGAGGGACAAC
ES584 FL574606 (CA)22 F: AGGGAAGTTGTAAAGGTAAGGA 49 56 9 222–240 0.429 0.863 0.0000*
R: ATGGGAATGAGATGAGGATAGA
ES645 FL571837 (AC)13 F: GACGCACGACAACAACCTC 60 56 11 122–158 0.522 0.912 0.0000*
R: CCACTCCTAGTCAACGGAAAGA
ES709 FL574505 (GCA)7 F: GCAGCCACAACCAGCAGAAG 60 60 6 197–212 0.233 0.219 1.0000
R: CTCGCCATGCAGGATCACC
ES776 FG357327 (CA)34 F: GTTGGTGTTGAAGGAGCCA 53 59 4 204–220 0.410 0.557 0.1180
R: CTTAATCCGTTGCGTCAGC
ES789 GE340666 (GT)25 F: TCGGGTGAGTTAGGTGTAGG 52 53 18 178–218 0.170 0.929 0.0000*
R: AGCAAGGCACTTTGAAGC
ES851 GE340258 (CAC)7 F: TCCAACCAGGCGGCAAAG 54 54 7 216–240 0.778 0.814 0.0580
R: AGCAAGTCCACCGAACACCAT
ES911 FL569216 (TTCA)7 F: CGGCGAGACTCACGAACT 56 53 5 242–258 0.453 0.634 0.0012*
R: CGAGGGTGAAGAGGCATT
ES998 FL572952 (GT)5N(TG)5N2(TG)12 F: CGACGGTGTCAGATTAGTG 56 51 8 217–231 0.392 0.860 0.0000*
R: ACCAACGGGCTCAAGAAG
ES1045 FL575077 (GT)28 F: GGAGCACCACCGTAAAGATA 55 55 17 112–148 0.582 0.935 0.2415
R: TCAACACGAAACCGCCAC
ES1053 FL572054 (CA)10 F: CTACACCAAGACCTCCTCGT 57 58 6 145–155 0.741 0.703 0.3476
R: GGCTGGTTTGTTGGGTAAG
ES1126 FG359126 (AAGG)12 F: TGTCCAGTCTCCCATCAA 54 60 14 180–240 0.883 0.907 0.7140
R: TGGTATGGTCGCTAATCTC
ES1139 FL569992 (GA)11 F: ACAGACGCACCTCCAAGC 55 59 20 110–150 0.644 0.925 0.0000*
R: TTAGAACAAACACGAGGGACA
ES1171 FG357452 (AC)8N5(TC)6 F:CAATCTGCCCTAATCTGTCTGTAA 57 55 8 156–172 0.900 0.871 0.0000*
R:GGGAAAGGTAGGAGGATAAGTGA
ES1178 GE341515 (ACC)7 F: TCCCATCGCCGTAGAAAC 55 60 3 138–146 0.150 0.144 1.0000
R: ACGCCAGACTGGACAAGC
ES1240 FG982578 (TACA)11 F: ATTGTAGCCATACCAGCAT 52 60 13 152–200 0.883 0.890 0.3087
R: ACAAATCTTACAACTACGGC
ES1289 FL574500 (TTA)13 F: ACCTTGTGGATACCAGCAT 50 55 12 124–169 0.782 0.872 0.0000*
R: TTCCCTTCAACCATACATAA
ES1293 FL569028 (GTA)7N8(GTA)5 F: GCCTCAATATCGGGCTTAT 55 59 7 129–176 0.763 0.769 0.2826
R: CCTCCCTGCGACTTCTACT
ES1300 FL575122 (TG)10 F: CCCTTGTTGATTGCCCTA 55 52 5 186–194 0.519 0.608 0.0846
R: GTCACGAAGAAGCACCTC
ES1482 FL576108 (TG)7 F: ACTATCCCTGCCTCACTACCG 57 60 7 115–129 0.250 0.522 0.0000*
R: GAACAAACATTACCGTCACTCG
ES1507 FL572842 (AGT)5N2(TAG)9 F: TGGAGTAGGTCGGTTCGGT 57 58 6 197–215 0.603 0.743 0.0299
R: TAGCAACATCCCTCGTCCTC
ES1513 FL574610 (AG)9 F: AACAGTGGCAGGAAACAGAAAG 57 56 7 100–114 0.217 0.739 0.0000*
R: AGGGAAGGATGAGTGTGAGCA
  1. T a annealing temperature, H O observed heterozygosity, H E expected heterozygosity
  2. * Significant departure (P < 0.05) from expected Hardy–Weinberg equilibrium conditions after correction for multiple tests (k = 30)