Skip to main content

Table 1 Primers used for the amplification of the large (L) RNA of Tomato spotted wilt virus WA-USA (TSWV WA-USA) isolate

From: Sequence characterization, molecular phylogeny reconstruction and recombination analysis of the large RNA of Tomato spotted wilt virus (Tospovirus: Bunyaviridae) from the United States

Oligonucleotides Sequence (5′-3′) Position
in L RNA
Expected
ampliconsize (bp)
TSWVF1 AGAGCAATCAGGTAACAACG 1 2782
TSWVR1 AATCGGACAGTGGCAAAAAC 2782
TSWVF2 GCGCAATTTTCAAAGAAAGC 2572 1822
TSWVR2 AACCAGTTCATGCTAACAGG 4394
TSWVF3 CAGAAGCCATATCTATAAGTGG 4001 2281
TSWVR3 GGTGGATAGGAGAGCCAATG 6282
TSWVF4 GGCAAAGACAGCTTCGAGAC 6082 2832
TSWVR4 AGAGCAATCAGGTACAACTAAAAC 8914