Skip to main content

Table 1 Primer sequences and amplification efficiency

From: The source of SYBR green master mix determines outcome of nucleic acid amplification reactions

Target Forward primer (5′–3′) Reverse primer (5′–3′) Amplicon (bp) Reagent Efficiency
GAPDH ACCCACTCCTCCACCTTTGAC TCCACCACCCTGTTGCTGTAG 110 ABI 0.98
TLR2 GTGATAGGTGTGAGGCAGGT GTGGCCGCCTTGATTCATAG 136 ABI 0.93
CD1c TTTCTGCAGTTTCTGCTGCTA GAGACGTGTTCCTGGGATG 74 ABI 1.06
CD54 CCTTCCTCACCGTGTACTGG AGCGTAGGGTAAGGTTCTTGC 90 ABI 1.05
CD68 TTCCCCTATGGACACCTCAG TTGTACTCCACCGCCATGTA 86 ABI 1
CCL4 CCTGCTGCTTTTCTTACAC CACAGACTTGCTTGCTTC 126 ABI 1.09
IL4 GTCTCACCTCCCAACTGCTT GTTACGGTCAACTCGGTGCA 157 Bio rad 0.99
IL4 GTCTCACCTCCCAACTGCTT GTTACGGTCAACTCGGTGCA 157 Roche 1.01
IL8 GAAGGAACCATCTCACTG CCACTCTCAATCACTCTC 200 Bio rad 0.96
IL8 GAAGGAACCATCTCACTG CCACTCTCAATCACTCTC 200 Roche 0.94
IL1RN CCTGTCCTGTGTCAAGTCTGG AGCGGATGAAGGCGAAGC 110 ABI 0.93
CEBPB CGCTTACCTCGGCTACCA ACGAGGAGGACGTGGAGAG 65 ABI 0.94
IL-18 TGCATCAACTTTGTGGCAAT ATAGAGGCCGATTTCCTTGG 169 ABI 1
V-FOS ACTACCACTCACCCGCAGAC CCAGGTCCGTGCAGAAGT 75 ABI 0.98
Egr-1 AGCCCTACGAGCACCTGAC GGTTTGGCTGGGGTAACTG 92 ABI 0.9
Egr-2 TTGACCAGATGAACGGAGTG TGGTTTCTAGGTGCAGAGACG 121 ABI 0.92
CD43 AAGATGTCATCAGTGCCCCA CACGGTGTGGGATCCTAGAG 90 ABI 0.93
CCR7 GGTGGTGGCTCTCCTTGTC ACTGTGGTGTTGTCTCCGATG 84 ABI 1.1
CD40 GCAGGCACAAACAAGACTGA ATGGCAAACAGGATCCCGAA 95 ABI 0.91
S01a GGTACCGGGTCTCCACATGA GGGAAAGTCACTCACCCAAGG    
S01b GTACCGGGTCTCCACCAGG GGGAAAGTCACTCACCCAAGG    
S03 CTTTTGCTTTCTGTTTCTTAAGGGC TCAATCTTTGGGCAGGTTGAA    
S04a CTGGTGCCCACAGTTACGCT AAGGATGCGTGACTGCTATGG    
S04b CTGGTGCCCACAGTTACGCT AGGATGCGTGACTGCTCCTC    
S05a AAAGTAGACACGGCCAGACTTAGG CATCCCCACATACGGAAAAGA    
S05b AGTTAAAGTAGACACGGCCTCCC CATCCCCACATACGGAAAAGA    
S06 CAGTCACCCCGTGAAGTCCT TTTCCCCCATCTGCCTATTG    
S07a TGGTATTGGCTTTAAAATACTGGG TGTACCCAAAACTCAGCTGCA    
S07b GGTATTGGCTTTAAAATACTCAACC CAGCTGCAACAGTTATCAACGTT    
S08a CTGGATGCCTCACTGATCCA TGGGAAGGATGCATATGATCTG    
S08b GCTGGATGCCTCACTGATGTT TGGGAAGGATGCATATGATCTG    
S09a GGGCACCCGTGTGAGTTTT TCAGCTTGTCTGCTTTCTGGAA    
S09b GGGCACCCGTGTGAGTTTT CAGCTTGTCTGCTTTCTGCTG    
S10a GCCACAAGAGACTCAG TGGCTTCCTTGAGGTGGAAT    
S10b TTAGAGCCACAAGAGACAACCAG TGGCTTCCTTGAGGTGGAAT    
S11a TAGGATTCAACCCTGGAAGC CCAGCATGCACCTGACTAACA    
Hy TTCTGGAACCTTTCTTTTCAGGC ACTTCCCTCTGACATTACCTGATAATTG    
HA-8p TGCAGTCAGCAGATCACCC CTTCTGGGCAACAGTTATGGA    
KIR3 DS1 CATCRgTTCCATgATgCg CCACgATgTCCAggggA    
TCCATCggTCCCATgATgTT