Skip to main content

Table 1 Panfungal internal transcribed spacer (ITS) primers utilized in this study

From: Rapid identification of fungi in culture-negative clinical blood and respiratory samples by DNA sequence analyses

Primer name Sequence (5′–3′) Reference
ITS2 GCTGCGTTCTTCATCGATGC 20
ITS3 GCATCGATGAAGAACGCAGC 20
ITS4FS TCCTCCGCTTATTNATATGCa F. Sidiq, unpublished
ITS4Z TCCTCCGCTTATTRATATGCa G. Zhang, unpublished
ITS5 GGAAGTAAAAGTCGTAACAAGG 20
LS266 GCATTCCCAAACAACTCGACTC 21
V9D TTAAGTCCCTGCCCTTTGTA 22
  1. aN = A, C, G, or T and R = A or G