Skip to main content

Table 1 Characteristics of the 32 microsatellite markers developed for Distylium lepidotum

From: Novel microsatellite markers for Distylium lepidotum (Hamamelidaceae) endemic to the Ogasawara Islands

Locus Repeat motif Forward primer sequence (5′–3′)a Reverse primer sequence (5′–3′)b Ta (°C) Size
range (bp)
GeneBank accession no.
Isu00524 (CT)30 [tail C] TTTATGCTTATTCACCCTTGAACC gtttAAACACCCATTAGTTCTTCTGTCTG 57 136–194 LC085250
Isu01062 (TC)25 [tail B] TACGAATGATGGGTCAAACTGTAA gtttGCCTTAAATTGACTGGAAGTGATT 57 228–270 LC085251
Isu01853 (AG)19 [tail D] CACTAGTTATTGAGGTAGGCGGGT gTTTGTTAACGAATGAGTTGGGATT 57 274–302 LC085252
Isu03838 (TC)24 [tail D] TTCCTGAAACGGTTACACAATACA gtttAGTGGAGATGATAAACGGATTGAC 57 111–135 LC085253
Isu04069 (GA)24 [tail B] TTAGATTTGAAGGCGATAAAGGTT gttTCCTTGATCTGTCCAATGTCA 57 135–171 LC085254
Isu04385 (TC)22 [tail A] AATGGGTCAGTGAGAATCTGTCTT gtttCAAGGAAATCGTATATGCAGAACA 57 215–245 LC085255
Isu04423 (GA)22 [tail B] AAGCAGAGCTTACCATGATTCACT gttTAGATCTCTGAGGAGGGACACATT 57 260–308 LC085256
Isu04472 (AG)26 [tail D] ATTTGGATCATCACTCGAGGTAAA gtTTATTCGTTTGCACTCTTATTTGA 57 214–266 LC085257
Isu04870 (CT)16 [tail B] TTAATTGGTTTCCCATTTGATCTC gtttCATGCAGATGCAGACTCTAAGAAG 57 285–299 LC085258
Isu04950 (GA)22 [tail A] AGACAATTCTGTGCTCCAGTATCA gtttAACATTGAAAGTTGAAGACCCAAC 57 263–299 LC085259
Isu04954 (TC)31 [tail A] CTAATCCAAATCAACCCATCTACG gtttCACCTCTCGTTTACTTCCATTGAT 57 128–156 LC085260
Isu05730 (AT)11 [tail A] ACATCGTCACCTCTATTAACCGAC gtttCAAGAGATTTCGAAGTGAAACAGA 57 346–366 LC085261
Isu06843 (AG)27 [tail B] GTTGACATCCCTACTCCTCCTACC gttTCTAAGCAAATGTGCATCGTTAGT 57 96–132 LC085262
Isu07049 (CT)26 [tail A] TCCATGTATTTATTTCGATCCTCC gtttGGGAAATACCATAAACATAAAGATGG 57 90–134 LC085263
Isu07063 (GA)24 [tail C] AGCTTGCATGAGGTTTCACTAAGA gtttCGACAACAGTACTAATCAACACGG 57 109–143 LC085264
Isu09807 (GA)23 [tail D] AACGCAAGATTTATCATTACCAGC gtttAAGACTCTCAAGATCTGTGCCAA 57 213–239 LC085265
Isu09853 (GA)22 [tail D] CAATTCCCTCAATTGTTGTTTCTT gtttAGAAACTTAAAGACAAACCGGGAT 57 304–326 LC085266
Isu10193 (GA)24 [tail B] ATTTATGTGGAAGTAGTAGCCGGA gttTACTGCTGGCTTGACATAGAAAGA 57 214–236 LC085267
Isu11459 (AG)19 [tail D] TAAAGCATCAAACAAGCGAATATG gtttACAATAAGAAAGCGACATGCTCA 57 265–291 LC085268
Isu12115 (GA)11 [tail A] TACGATTCAAGCTTGTCATACTCG gtttATATTTACGCGCAAACTCTCGC 57 413–417 LC085269
Isu12238 (CT)24 [tail D] CCAAGATTATGCAACCTAAGGAAG gtttACCCTGAATTCCATCTAGACCTTT 57 116–156 LC085270
Isu12265 (TC)21 [tail C] TGATAGATACATGTCCCACTGTCTT gttTAAACCTAGCCAAACAAATCCAAC 57 85–121 LC085271
Isu12586 (AT)11 [tail C] TAGACAACTTTCTGGATCAAAGCC gtttGGCTGTGTATATGTATGCGTGTTT 57 319–359 LC085272
Isu13849 (CT)12 [tail D] CAAGATCAAGATTGAAATGGAATTG gtttATCCGATAGATCAGTACTTGGTGG 57 326–350 LC085273
Isu13965 (AG)25 [tail B] GTGTAAGTTGTGGGTTTAACGGAT gtttAAGACATCAGCAAACTAGTCCACC 57 155–183 LC085274
Isu15054 (TC)24 [tail A] CGGGATGTAAACATAGATGTCAAA gttTATGGCCTAGGAAGATAATGTTGG 57 219–273 LC085275
Isu16246 (CT)26 [tail C] AATCATGTAGCGAGCTTGAACTTT gtttCATGAATATGAGCACAAGGTATTATTT 57 132–174 LC085276
Isu16408 (TC)18 [tail C] AGATTACTGCTTCGTTCGACCTTA gtTTGGTGCTATAATTAGGATTTGGC 57 285–307 LC085277
Isu16655 (CT)16 [tail C] GAAAGGTAGGTCCATAACTCCACA gtTTGAGGATACAATGCTTTCACTTG 57 270–290 LC085278
Isu16805 (GA)26 [tail B] CGCTCTTAAACAGAATATGGAAGG gtttGATTGTCAATTCCACGGAGAAC 57 83–115 LC085279
Isu17435 (AG)20 [tail B] TAAATACAAAGATGATGTGCCAGC gttTGTACATGTAGTTCCCAGGCAAT 57 82–114 LC085280
Isu17619 (AG)13 [tail A] CAATTCCCTTGTGAAGAATTATCG gtttGTTTACAGTACTGCACTGACGCAT 57 317–329 LC085281
  1. Ta = annealing temperature
  2. aTails of the forward primers are indicted as follows: [Tail A] = 5′-GCCTCCCTCGCGCCA-3′; [Tail B] = 5′-GCCTTGCCAGCCCGC-3′; [Tail C] = 5′-CAGGACCAGGCTACCGTG-3′; and [Tail D] = 5′-CGGAGAGCCGAGAGGTG-3′
  3. bReverse primer sequences contained the PIG-tail sequence [2]. Tail sequences are shown in lower case letters
\