Skip to main content

Table 1 Characterization of 23 microsatellite markers in 15 forest elephants from Lope National Park, Gabon

From: Development and characterization of microsatellite markers in the African forest elephant (Loxodonta cyclotis)

Locus Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′) n No. of alleles Ho He I Allele size range (bp) Repeat motif GenBank accession no.
Lcy-M4 Lcy-M4-F: GGAGAGAGTCTGTGCACCTC Lcy-M4-R: ATGAGTGTGTGCATGGAACG 15 4 0.27 0.43 0.82 122–128 (AC)8 KU947083
Lcy-M6 Lcy-M6-F: ACGGCAATTTAAGATGGAGCC Lcy-M6-R: CGGTCATTTGCAACACTGTG 15 5 0.80 0.72 1.33 130–140 (AC)9 KU947085
Lcy-M8 Lcy-M8-F: TTGAAATTCAGATCAGCGTGTG Lcy-M8-R: CAGGGCTTTAGTTCACGCTC 15 6 0.67 0.72 1.42 125–149 (TG)8 KU947086
Lcy-M16 Lcy-M16-F: CTGATCACTTCTTAGCGGTGTC Lcy-M16-R: GGTGTTCCTGGACATCTGCC 15 5 0.67 0.69 1.26 133–155 (AC)14 KU947088
Lcy-M17 Lcy-M17-F: GGAGCTCAGGAAATACACAGC Lcy-M17-R: TGATCGCCTCTGTTTCGTTC 15 4 0.47 0.40 0.73 146–156 (TG)11 KU947089
Lcy-M23 Lcy-M23.2-F: TGAAGGCGTCTCTGTTATTGC Lcy-M23.2-R: GAAGCCAAGCAAATGGGATA 15 4 0.60 0.46 0.87 160–168 (AC)12 KU947092
Lcy-M24 Lcy-M24.2-F: GATGACTCTGGCTCCTGGAT Lcy-M24.2-R: CGCCCTGACTGGTCTTACTC 15 5 0.80 0.76 1.43 114–132 (TG)16 KU947093
Lcy-M26 Lcy-M26-F: CAACCAAGTTCTGCCTGCTG Lcy-M26-R: CGTGGTCTCTTTGCTGTCAC 15 7 0.80 0.86 1.85 148–162 (AC)10 KU947094
Lcy-M27 Lcy-M27.2-F: TCCTTGATGTGGTTTCAGTCA Lcy-M27.2-R: GGTAGGTTGGCTATGTTTCTTG 15 3 0.53 0.48 0.80 123–131 (AC)9 KU947095
Lcy-M29 Lcy-M29-F: AGCCTCTTTCTTTCCGTTGC Lcy-M29-R: AGATCCTCAGGGTAATTTGCAC 15 5 0.47 0.67 1.22 160–170 (TG)8 KU947096
Lcy-M30 Lcy-M30-F: CACTACGCCAACAGGTTTCC Lcy-M30-R: TGTCCCATAGTGTCACCGTG 15 3 0.60 0.52 0.87 150–156 (AC)8 KU947097
Lcy-M40 Lcy-M40-F: TTCAAGTACCTGCTGTCACTG Lcy-M40-R: TTCTGTCCAAGTAGCTTACCTG 15 3 0.47 0.57 0.88 160–166 (AC)9 KU947099
Lcy-M43 Lcy-M43.2-F: TCCTCACTGCCACAACCAT Lcy-M43.2-R: GGGTCTCTTCCCATCATCAG 15 8 0.87 0.81 1.83 135–155 (AC)26 KU947101
Lcy-M44 Lcy-M44.2-F: GGCCTGATATAGCCCTTGT Lcy-M44.2-R: TCCTGCTGTACTTGAATTTCTGA 15 6 0.80 0.77 1.57 128–144 (AC)11 KU947102
Lcy-M45 Lcy-M45.3-F: CAGCTATTCTATCCTCACAAGTCCT Lcy-M45.3-R: TGTGAATGGAGAGTTTTCTCTGA 15 8 0.87 0.85 1.86 123–147 (AC)18 KU947103
Lcy-M50 Lcy-M50.2-F: CCCAGGACCAGCATAGTGAT Lcy-M50.2-R: TGGAATAAATCAAGAGTAAGAATTCAC 15 4 0.60 0.56 1.02 137–147 (AG)11 KU947104
Lcy-M15a Lcy-M15-F: AATCAGGCAGCTAACAACGG Lcy-M15-R: CAGCCCTTCACAGAAAGTCC 15 2 0.07 0.07 0.15 148–150 (TG)9 KU947087
Lcy-M20a Lcy-M20.2-F: GTCTTCCAAAGCACCCTCTG Lcy-M20.2-R: AATAGACGGGAGAGGGGAGT 15 2 0.47 0.36 0.54 156–158 (AC)10 KU947090
Lcy-M22a Lcy-M22-F: CTTGAGCCTGCTGTATGTGC Lcy-M22-R: CAGAAGCTGGATGGTCAAGC 15 2 0.13 0.13 0.25 155–157 (TG)10 KU947091
Lcy-M39a Lcy-M39.2-F: CATGGTGACTGCTGCATTG Lcy-M39.2-R: TGTTGCTTGTTCTGTCCCTAGA 15 2 0.07 0.28 0.45 157–163 (AGC)10 KU947098
Lcy-M5a Lcy-M5-F: GTAGTTGCCTCAAGTTCCAGC Lcy-M5-R: CTCCAACACTCCTCCCTCTG 15 1 0.00 0.00 0.00 121 (AT)10 KU947084
Lcy-M42a Lcy-M42.2-F: AAGGCATATGCAGGAAGCTG Lcy-M42.2-R: AACTGTGCTCCAGGGTCACT 14 1 0.00 0.00 0.00 120 (AC)19 KU947100
Lcy-M52a Lcy-M52-F: CCGTAAGCTAATCCTCCTGC Lcy-M52-R: ATTTGCCTTTGTTCCTGCCG 15 1 0.00 0.00 0.00 168 (AC)8 KU947105
  1. An M13 forward tail (TGTAAAACGACGGCCAGT) that was at the 5′ end of each forward primer is not shown above
  2. PCR algorithms are detailed in Additional file 1
  3. Allele sizes shown here include both forward and reverse primer lengths including the M13 forward tail length
  4. Ho and He represent observed and expected heterozygosity, respectively, I represents Shannon’s diversity index
  5. aLinkage disequilibrium and deviation from Hardy–Weinberg equilibrium were not examined due to low genetic diversity