Skip to main content

Table 2 Primers used in this study

From: Pipeline for amplifying and analyzing amplicons of the V1–V3 region of the 16S rRNA gene

Primer name Sequence (5′–3′)a
i5+V3 AATGATACGGCGACCACCGAGATCTACAC ATCGTACGTATGGTAATTCAATTACCGCGGCTGCTGG
i7+V1 CAAGCAGAAGACGGCATACGAGAT AACTCTCGAGTCAGTCAGCCGAGTTTGATCMTGGCTCAG
For.seq.V3 TATGGTAATTCAATTACCGCGGCTGCTGG
Rev.seq.V1 AGTCAGTCAGCCGAGTTTGATCMTGGCTCAG
Index.V1 CTGAGCCAKGATCAAACTCGGCTGACTGACT
  1. aIllumina’s MiSeq adaptor sequences are in bold. Underlined portion denotes the barcode region. Barcodes used in this study are from the Schloss laboratory’s MiSeq SOP (http://www.mothur.org/wiki/MiSeq_SOP; [2]). Italics denotes the V1 or V3 16S rRNA gene primer [11]
\