Skip to main content
Fig. 3 | BMC Research Notes

Fig. 3

From: Helicobacter cinaedi bacteremia with cellulitis in a living-donor kidney transplant recipient identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry: a case report

Fig. 3

Detection of Helicobacter cinaedi in blood using gyrase subunit B-targeted polymerase chain reaction. M molecular size marker, Nc negative control: distilled water (DNA- and DNase-free water). Polymerase chain reaction was performed using the forward primer AGGGATTCCACAAAGTGAGC and the reverse primer TCTTGTCCTGTGCGTTCATC. This resulted in a product of 195 base pair

Back to article page

BMC Research Notes

ISSN: 1756-0500

Contact us