Skip to main content

Advertisement

Table 2 Details for the 15 selected, validated Sium latifolium microsatellite loci

From: The characterisation of microsatellite markers reveals tetraploidy in the Greater Water Parsnip, Sium latifolium (Apiaceae)

Locus Sequence identifier and accession no. Primer sequences (5′–3′) Repeat motif T (°C)
Sla01 GWP00014, LN849725 F: [6FAM]AGACTTGTATGTCCTGCATTATGTTC
R: CAGCTGGTGAAGCCAATTTAG
(GT)13 58
Sla02 GWP00025, LN849726 F: [HEX]TTGCCTCAAGTGCAGAACAG
R: CAACCACTTACATATGTTCACAATACC
(CT)15 58
Sla03 GWP00030, LN849727 F: [6FAM]ACCAATGACAAGTGGGTTCC
R: CCCAAGATTTCCTTGAAGTACAG
(CA)28 53
Sla04 GWP00089, LN849728 F: [HEX]GATTCCCGATCTCCAATTCC
R: CGCGACATCGAAGAGTTTG
(CA)13 53
Sla05 GWP00130, LN849729 F: [6FAM]AGAAGCACGCTATTGCACTG
R: CATTTGTCAGTTGTCACATACCC
(GT)10 58
Sla06 GWP00133, LN849730 F: [6FAM]TTGCAAGGAAACTGAGACCAC
R: TGGACATTGTACCAGCTACCC
(CT)14 51
Sla07 GWP00178, LN849731 F: [6FAM]GGACATCTAAGCATAAAGTGCAATAAC
R: TTGTTTCTAGCAGAGGTAGCTTGAC
(CA)18 58
Sla08 GWP00226, LN849732 F: [HEX]CAGATGGATAGTTGAAACCAAGTG
R: TTAAGTTAGACAAGCGGCCTTC
(CA)12 51
Sla09 GWP00268, LN849733 F: [HEX]CAGCAAGAATTGCCAATCG
R: AATGGTGAAGGGAAATGCTG
(GT)12 58
Sla10 GWP00318,LN849734 F: [HEX]TTACTTGCCCACGCTTCTG
R: TCTTCTAAAGCAGGGGAGTACG
(CT)15 51
Sla11 GWP00319, LN849735 F: [6FAM]TGATACGGTGGATGATGAGC
R: TGCATTATATGCGTCAACTGG
(GT)12 (GA)8 58
Sla12 GWP00373, LN849736 F: [6FAM]GCCACAGTAGATCCATTACTCAAC
R: TTTGACACAGATTGGAATCCTC
(GT)16 51
Sla13 GWP00423, LN849737 F: [HEX]CCTTAACTAAAGACTAAAGACTGTGGAAC
R: ACTTGGTCGGTTATGTTGTGG
(GA)13 58
Sla14 GWP03443, LN849738 F: [6FAM]CTGGCAAACACACGCAAC
R: TTTCTTTGTTTGGGTTTGATCTC
(GA)13 58
Sla15 GWP03601, LN849739 F: [6FAM]TTGTAAACGCCCTTACCATTG
R: AATAAACCATGAACAGATGAAGATTG
(GT)15 51
  1. Microsatellite loci, sequence identifier and EMBL/EBI accession number, sequence of primers, repeat motifs, optimum primer annealing temperatures (T °C)