Skip to main content

Table 1 Primers and targets

From: Simple and fast quantification of DNA damage by real-time PCR, and its application to nuclear and mitochondrial DNA from multiple tissues of aging zebrafish

Primer Sequence Amplicon (bp) Target
AHRLF GTCCTTGCAGGTTGGCAAATGG 3502 AHR2
AHRLR GACCTTGTCTGGTTTTCATCCC   
AHRSLF TCATCCTGTTATCCACCACACTGTTG 1637 AHR2
AHRSLR TGGTTCTTGGCTACACTGAGATTGAG   
AHRRF CCAAGGTCCGACATAACTCACTTCTG 55 AHR2
AHRRR GACATGATGTACTGTGCTGACAACCA   
mtLF TTAAAGCCCCGAATCCAGGTGAGC 3669 mtDNA coding region
mtLR TTAGGGGTAGTGAGTTTTGGGTC   
mtSLF GGATTCCAAGACGCAGCATCACCTG 1978 mtDNA coding region
mtSLR GGAGCGGCACTTCAAATGGGTCAAG   
mtDLPF CCTTACACGATTCTTCGCATTCCAC 1939 mtDNA D-loop region
mtDLPR GGCTTGGCTAGGCGTCTTGG   
mtRF CGAGGAGCAGGTATCAGGCACA 55 mtDNA coding region
mtRR GTGGCTTGGCTAGGCGTCTTG