Skip to main content

Table 1 List of PCR primers

From: Conserved sequences of BART and BHRF regions encoding viral microRNAs in Epstein-Barr virus-associated lymphoma

Set Targets Strand Name of primer Start End Sequence (5′-3′) Size of PCR product
E1 miR-BARTs3,4,1 Forward EBV139081F 139,081 139,100 tccctgtaaacacacaccac 440
Reverse EBV139520R 139,520 139,501 ttctacatcatgcctggttc  
E2 miR-BARTs15,5,16,17,6 Forward EBV139501F 139,501 139,520 gaaccaggcatgatgtagaa 690
Reverse EBV140190R 140,190 140,171 tttagatctgtggttacatg  
E3 miR-BARTs21,18 Forward EBV145451F 145,451 145,470 ttagatgttagctttgtgtt 590
Reverse EBV146040R 146,040 146,021 ggcccaaaccttcgcagcag  
E4 miR-BART7 Forward EBV145911F 145,911 145,930 ttgttgccgttgaaagacgg 610
Reverse EBV146520R 146,520 146,501 tggccacactaaacacacaa  
E5 miR-BARTs8,9 Forward EBV146701F 146,701 146,720 ttatttgggttacaagacct 350
Reverse EBV147050R 147,050 147,031 cacaatgaaacccaaagccc  
E6 miR-BARTs22, 10,11 Forward EBV147131F 147,131 147,150 cggttgtcacaggtgctaga 500
Reverse EBV147630R 147,630 147,611 cgtgaaaggcactccagaat  
E7 miR-BARTs12,19,20 Forward EBV147871F 147,871 147,890 acctaagacccgcccatcac 550
Reverse EBV148420R 148,420 148,401 ccaaaggacccgggatcacg  
E8 miR-BARTs13, 14 Forward EBV148461F 148,461 148,480 catcttgacgttggaatgtc 360
Reverse EBV148820R 148,820 148,801 ctcctgggttggcgtttccg  
E9 miR-BART2 Forward EBV152651F 152,651 152,670 gcagcaaaagaggaacttgc 350
Reverse EBV153000R 153,000 152,981 ggcaaagatccccagcggag  
E10 miR-BHRF1-1 Forward EBV41581F 41,581 41,600 cctcaccatgacacactaag 260
Reverse EBV41840R 41,840 41,821 ccagatgcacccaacagccc  
E11 miR-BHRF1-2,3 Forward EBV42991F 42,991 43,010 gggtgacacagtgcccatgc 330
Reverse EBV43320R 43,320 43,301 acactcacctcagttatttc  
  1. Nucleotide numbering is based on GenBank KF373730