Skip to main content

Advertisement

Fig. 2 | BMC Research Notes

Fig. 2

From: Dubin–Johnson syndrome and intrahepatic cholestasis of pregnancy in a Sri Lankan family: a case report

Fig. 2

Sanger sequence chromatograms of exons 17 and 13 of ABCC2 and ABCB11 genes, respectively, for the child and mother. The genomic DNA was from peripheral blood using Puregene Kit (QIAGEN), and primers’ sequences for polymerase chain reaction were designed as follows: ABCC2_17F 5′TGGGGCTTTTAATGGTGAAG3′. ABCC2_17R 5′GTGTAGTTCTTCACCACCATC3′. ABCB11_13F 5′ACTTCTTGGTCATGGCTCTCAG3. ABCB11_13R 5′AGCGTGTCCCATCAATTCAG3′

Back to article page