Skip to main content

Table 1 Primer or probe sequence for intratypic differentiation (ITD)

From: Vaccine-related poliovirus shedding in trivalent polio vaccine and human immunodeficiency virus status: analysis from under five children

Specificity Primer or probe (polarity) Primer or probe sequence (5′ → 3′)
Pan-enterovirus PCR-1(A)
PCR-2 (S)
PanEV probe (S)
GCGATTGTCACCATWAGCAGYCA
GGCCCCTGAATGCGGCTAATCC
FAM-CCGACTACTTTGGGWGTCCGTGT-BHQ1
Pan-poliovirusa panPV/PCR-1(A)
panPV/PCR-2(S)
panPV Probe21A(A)
AYRTACATIATYTGRTAIAC
CITAITCIMGITTYGAYATG
FAM-TGRTTNARIGCRTGICCRTTRTT-BHQ1
Serotype 1a seroPV1A(A)
seroPV1,2S(S)
seroPV1 probe 16A(A)
ATCATIYTPTCIARPATYTG
TGCGIGAYACIACICAYAT
FAM-TGCCYAVICCYGIGMIADYGC-BHQ1
Serotype 2 seroPV2A (A)
seroPV1,2S (S)
seroPV2,probe 5S (S)
AYICCYTCIACIRCICCYTC
TGCGIGAYACIACICAYAT
FAM-CARGARGCIATGCCCICARGGIATNGG-BHQ1
Serotype 3a seroPV3A (A)
sero PV 3S (S)
seroPV3,probe 11S (S)
CCCIAIPTGRTCRTTIKPRTC
AAYCCITCIRTITTYTAYAC
FAM-CCRTAYGTNGGITTRGCVAAYGC-BHQ1
Sabin 1 Sab1/PCR-1(A)
Sab1/PCR-2(S)
Sab1/probe (A)
CCACTGGCTTCAGTGTTT
AGGTCAGATGCTTGAAAGC
CY5-TTGCCGCCCCCACCGTTTCACGGA-BHQ3
Sabin 2 Sab2/PCR-1(A)
Sab2/PCR-2(S)
Sab2/probe (S)
CGGCTTTGTGTCAGGCA
CCGTTGAAGGGATTACTAAA
FAM-ATTGGTTCCCCCGACTTCCACCAAT-BHQ1
Sabin 3 Sab3/PCR-1(A)
Sab3/PCR-2(S)
Sab3/probe (S)
TTAGTATCAGGTAAGCTATC
AGGGCGCCCTAACTTT
ROX-TCACTCCCGAAGCAACAG-BHQ2
  1. Degenerate primers: K=G and T; M=A and C; R=A and G; Y=C and T; I = degenerate base analog, Inosine; P = degenerate base for (TC)
  2. aWe used degenerate PCR conditions with these primer sets