Skip to main content

Table 2 Primer or probe sequence for Sabin vaccine derived poliovirus (VDPV)

From: Vaccine-related poliovirus shedding in trivalent polio vaccine and human immunodeficiency virus status: analysis from under five children

Primer specificity Primer and probe sequences 5′ → 3′
S1 VDPV VP1 (Target aa# 99) Sense CATGCGTGGCCATTATA
Anti-sense CAAATTCCATATCAAATCTA
VP1 probe FAM-CACCAAGAATAAGGATAAGC-BHQ1
S2 VDPV VP1 (Target aa# 143) Sense GACATGGAGTTCACTTTTG
Anti-sense CTCCGGGTGGTATATAC
VP1 probe FAM-CATTGATGCAAATAAC-BHQ1
S3 VDPV VP1 (Target aa# 285–290) Sense CATTTACATGAAACCCAAAC
Anti-sense TGGTCAAACCTTTCTCAGA
VP1 probe FAM-TAGGAACAACTTGGAC-BHQ1