Skip to main content

Advertisement

Table 1 Oligonucleotides used for amplification with qPCR and dPCR

From: A comparative study of digital PCR and real-time qPCR for the detection and quantification of HPV mRNA in sentinel lymph nodes of cervical cancer patients

Oligonucleotide Sequence (5′ → 3′) HPV position
qPCR forward primer AATGTTTCAGGACCCACAGG 103–122
qPCR reverse primer CTCACGTCGCAGTAACTGTTG 206–226
dPCR forward primer TTCGGTTGTGCGTACAAAGC 755–774
dPCR reverse Primer AGTGTGCCCATTAACAGGTCTTC 799–821
dPCR TaqMan-MGB probe CACGTAGACATTCGTACTT 778–796