Skip to main content

Advertisement

Table 1 Primers

From: Limitations of lymphoblastoid cell lines for functional analysis of SNPs

No. Sequence 5′–3′ Tm (° C)
117 TTTGGTGTTGAAATTAGAGTT 60
118 GAGGTATGGTTGTGTGATTG 60
119 ACTCACTACAAACTCTACCTCC 60
524 GTTAAAGGTATATATTGGGGGT 60
525 TATTGGGGGTTTAATTAAGG 60
529 CTTCCTAAAAACCTACGAAAA 60
846 GTGTTAGGTGGTTTTATTTTTTG 62
847 AAACTACCTCTACCATTCCTC 62
  1. List of the primers used. Primers 117–119 were used to amplify the negative regulatory region; primers 524–529 for core promoter and 846–847 for positive regulatory region amplification
  2. Tm melting temperature, °C degree Celcius