Skip to main content

Table 1 The oligonucleotides listed were applied in RT-PCRs to validate non-canonical splice sites selected candidate genes in Nd-1

From: Consideration of non-canonical splice sites improves gene prediction on the Arabidopsis thaliana Niederzenz-1 genome sequence

Name Gene Sequence Length Orientation Recommended annealing temperature [°C]
S015 At1g79350 (FGT1) GCTTCCCTGGAGTGCTGATCG 21 Forward 61
S016 At1g79350 (FGT1) TCGGGTTCATCAATCGAGCATCC 23 Reverse 61
S003 At4g01800 (AGY1) ACTGGTGAAGGGAAAACGCTTG 22 Forward 59
S004 At4g01800 (AGY1) AATGTATATCCCGCTCAAAGGCTG 24 Reverse 59
S018 At4g27500 (PPI1) AGCCGCAGAAGGAAGAAAAGC 21 Forward 59
S019 At4g27500 (PPI1) ACGCGATGAGACGAATTCCGAG 22 Forward 61
S020 At4g27500 (PPI1) CTCTTGGGATCGTTTCTGGTCC 22 Reverse 59