Skip to main content

Advertisement

Table 1 Characterisation of 24 new L. malachurum microsatellites

From: Identification of 24 new microsatellite loci in the sweat bee Lasioglossum malachurum (Hymenoptera: Halictidae)

Locus name GenBank sequence accession number Panel and dye Repeat motif Primer sequence (5′–3′) Na tested N alleles Expected allele sizeb, size range HObs HExp HWE p value Est. F (null) L. cal successc
Lma02 MG273262 1 (TC)13 F: CCGAGTTCATCAACATCCTC 23 10 150 0.87 0.83 0.712 − 0.037 P
   NED R: TTGATTATCAGCGAGATGAGC    139–185      
Lma03 MG273263 1 (AG)14 F: AAAGCGTTGCGAGACACC 38 7 154 0.816 0.745 0.103 − 0.063 P
   PET R: AGCATAATGGAAACCCAACG    137–167      
Lma04 MG273264   (TG)12 F: CGTTACCGCGTTGGTTTC 37 6 169 0.649 0.727 0.162 0.034 M
    R: GTCTTGTCTAACCGCAACAGC    165–177      
Lma12 MG273265 2 (CT)12 F: CCAACCGAACACCAACTTTC 39 10 150 0.667 0.701 0.413 0.017 P
   PET R: CTCCCGGGTTGTCATGTAAG    131–181      
Lma14 MG273266 1 (AG)14 F: CAACGCGTGACAGGTGATAC 40 14 170 0.825 0.896 0.186 0.035 P
   6-FAM R: CGGCTACGTTCCACTATGAAG    162–192      
Lma20 MG273267   (AG)19 F: AGCGCTCGATGACTGTCG 39 17 210 0.872 0.889 0.087 0.007 F
    R: TTGCGCAAGCCGTTCTAC    196–262      
Lma21 MG273268 2 (GA)16 F: CGGTAAACTTGCTTCGACCTG 38 11 137 0.868 0.85 0.053 − 0.026 F
   NED R: CCGATTCCTTCACAGACACG    135–156      
Lma23 MG273269   (GA)13 F: GATAATCAATGGTAATCGGTTGG 40 11 167 0.85 0.838 0.179 − 0.017 M
    R: TTAACATCGTTCGCTTCTCG    154–218      
Lma24 MG273270 2 (GA)13 CA (GA)6 F: TCCTCGGACAAGGAGATACG 40 13 172 0.925 0.891 0.723 − 0.026 P
   6-FAM R: TTCGGGTACCGTTCAGTCTC    141–181      
Lma27 MG273271   (GA)13 F: GCTGGCAGCTCTGGAGAAG 38 9 189 0.737 0.804 0.071 0.032 P
    R: TGACGGCCATTTAGTTCGTC    177–199      
Lma29 MG273272 1 (CT)4 TT (CT)9 F: CTCGTCCCTCGTGTGACTC 38 12 204 0.868 0.883 0.725 0.003 P
   PET R: GTATCGTGCGTGCGTGTC    201–231      
Lma30 MG273273   (GACGA)6 F: TCCGTCTCTGGTCGATACTG 38 3 237 0.447 0.407 0.854 − 0.075 P
    R: ACAGCAGCATCTGAACTTGC    225–235      
Lma31 MG273274   (TCTT)10 F: CGCACTCCGCTTTTCCTC 40 6 146 0.55 0.664 0.049 0.084 P
    R: CGTCACCAGGAGAGCAAGG    142–164      
Lma34 MG273275   (CT)12 F: TCTGAACAGTACGGAACAATGC 40 6 176 0.675 0.684 0.718 − 0.009 P
    R: ACCGACACGGGAGAGAGAG    165–179      
Lma36 MG273285 1 (CT)16 F: GGCCCTTCGACTTTGTTG 38 8 188 0.737 0.785 0.298 0.027 P
   VIC R: GAATCTCTGGGTGCTCTAACG    185–199      
Lma39 MG273276 2 (CTAT)8 F: CGAGCCTATGCAGAGAACAG 38 7 205 0.789 0.75 0.68 − 0.034 P
   PET R: TGGATGGCTGCTGAGTAAAC    205–237      
Lma40 MG273277 2 (GA)12 F: CGTTCGTTCGTTCGTTACTG 38 14 150 0.947 0.906 0.74 − 0.029 P
   VIC R: CAGAGTGCGTCGCTTGTTAG    155–189      
Lma42 MG273278   (AG)13 F: ACCATCGCCCTTCCACTAC 40 5 167 0.75 0.733 0.623 − 0.016 P
    R: CCGAAACTATTCGCCCATC    161–169      
Lma48 MG273279 2 (TC)14 F: GTTGGATGCATCTGGAGGAC 38 6 206 0.763 0.722 0.14 − 0.043 M
   NED R: TGCGGTGGTTATTGATTTCC    193–209      
Lma49 MG273280   (GAAA)10 F: GAGAGGGTGGTTGCACTACG 38 4 209 0.684 0.62 0.786 − 0.055 M
    R: CTCGTGGAATCGAACTCACC    189–209      
Lma50 MG273281   (CT)3 CG (CT)12 F: CGTTTAACCGGCTCGCTAC 38 8 181 0.684 0.763 0.726 0.051 P
    R: CCGCGAATAAGTGGAGTGTC    163–209      
Lma51 MG273282 1 (CT)11 F: GAGAAATTGCCAGCAAACATC 40 4 243 0.475 0.545 0.259 0.066 P
   6-FAM R: AGTTTCGTGGAAGGGAACG    237–243      
Lma52 MG273283 1 (TG)11 F: CGGCAACTGCTTGCATAAC 40 5 156 0.8 0.732 0.575 − 0.056 M
   VIC R: CCCGTAGCACTCGCATACTC    151–159      
Lma53 MG273284 1 (AC)12 F: ACGCGGGATTACTTTCAATC 40 9 228 0.675 0.759 0.053 0.057 P
   NED R: CCAATTATCGGGTGAAGGAG    217–241      
  1. aN: number of diploid, unrelated L. malachurum females genotyped (all from the same population at Denton)
  2. bBased on the sequenced individual (sample M4); Hobs and HExp: observed and expected heterozygosities; HWE: p value when testing for deviation from Hardy–Weinberg equilibrium; F(Null): Estimated frequency of null alleles
  3. cAmplification success across 14 L. calceatum individuals: F failed to amplify, M monomorphic, p polymorphic