Skip to main content

Table 2 Identification of a further 29 markers that were rejected and not considered for multiplex panels

From: Identification of 24 new microsatellite loci in the sweat bee Lasioglossum malachurum (Hymenoptera: Halictidae)

Locus name GenBank sequence accession number Repeat motif Primer sequence Expected allele size Reason for dropping (tested in 23–24 individuals)
Lma01 MG273287 (TGAC)7 F: AACGCCTCGGTGAACCTG 108 Monomorphic
Lma05 MG273288 (TTTC)7 F: ATGCGTCTAAATCGTTCCTG 178 Monomorphic
Lma06 MG273289 (AG)11 F: CGGGAACGACGGAGAGAG 184 False peaks
Lma07 MG273286 (GAAA)5 F: GTCATGGAGAGGGTGGTTG 189 No product
Lma08 MG273290 (TTCT)7 F: CTATCCGAGGCCTGTACACTG 192 No product
Lma09 MG273291 (AGAA)5 F: ACGGGACTGAAAGGGACAC 201 Monomorphic
Lma10 MG273292 (AAAG)7 F: GAGACAACGAGGGAGAAAGC 206 Stutter
Lma11 MG273293 (GA)7 F: CTTGTACCACGCGTACACACC 111 False peaks
Lma13 MG273294 (CT)18 F: GCTCATCGAGGACGAGGTG 154 False peaks
Lma15 MG273295 (TGCT)5 F: GGACAGTCCGACGAAGGAG 179 No product
Lma16 MG273296 (TC)20 F: ACATTGTTCACCGGACAAATC 187 Monomorphic
Lma17 MG273297 (TC)11 F: GTCAACGGTAATCCGAGGTG 189 False peaks/Stutter
Lma18 MG273298 (AG)16 F: GGGATACTAGACAGCCGGAATATAG 193 False peaks
Lma19 MG273299 (TC)20 F: TGTAAACGGCCGAAGTGTC 203 False peaks/Stutter
Lma22 MG273300 (TCTT)5 F: GCCGGACCAGATTAAATGC 151 No product
Lma25 MG273301 (CTAT)6 F: CGAAATACCGTTAACCAACATC 180 Monomorphic
Lma26 MG273302 (AG)16 F: CTTCGATTCCTCGGGTCAC 188 No product
Lma28 MG273303 (CT)17 F: ATTCGCGACAATGAACGAG 193 False peaks
Lma32 MG273304 (TC)16 F: CGACGTACCTCTGCTTCCTC 152 Stutter
Lma33 MG273305 (GA)19 F: CTCTTCTCGATTCCGTCTGG 167 False peaks
Lma35 MG273306 (GAGT)5 F: CCTTCGAGAGGTCAGAGCTAAAG 181 No product
Lma37 MG273307 (TTCT)5 F: GTGGCCTATGCTCCTCTCC 190 Monomorphic
Lma38 MG273308 (GACA)9 F: AGAGACAAAGGCGGAGACAG 197 False peaks/Stutter
Lma43 MG273310 (AG)17 F: TTCAGCCGAGGGTAGCAC 178 False peaks
Lma44 MG273311 (AG)15 F: ATGAGACTGGCACGACTGTG 182 False peaks
Lma45 MG273312 (CT)15 F: TTTCGCATCCATCTTCCTTC 189 False peaks/Stutter
Lma46 MG273313 (TCCT)5 F: TCCCTTTACCTTCCTTTCTCG 190 Monomorphic
  1.  Based on the sequenced individual (sample M4)