Skip to main content

Table 2 Characterization of 16 polymorphic microsatellites for the rock ptarmigan (regular font) and the willow grouse (italics)

From: Development and evaluation of 16 new microsatellite loci for the rock ptarmigan (Lagopus muta) and cross-species amplification for the willow grouse (L. lagopus)

Locus name Repeat motif of cloned allele GenBank accession number Primer sequence (5′–3′) Primer dye Allele size range (bp) Na H E H O
Mut01 (ATCC)8 MF425753 F: GGTCACTTGTGGCTATTAGAACC PET 85–104 6 0.6545 0.6129 [0.0016]**
R: CTGAGAAAGACAATGGTGGATGG 85115 8 0.7361 0.6667 [0.0606]
Mut02 (ATCC)9 MF425754 F: GATGGATGAACAGACAGTGGATG FAM 99–127 8 0.6454 0.6984 [0.7326]
R: CACTCACTTGCTTATATGATTCCC 103127 6 0.7243 0.5366 [0.0001]***
Mut03 (AAAC)7 MF425755 F: TCACTAAATCATGGAAAGCAATGG NED 100–116 5 0.6925 0.7069 [0.8376]
R: GGTGAGGTGGATTATCATATGCAG NA NA NA NA
Mut04 (ATCC)11 MF425756 F: AACATGGTCCTACACTTCAGAGG VIC 107–131 6 0.7602 0.8571 [0.9064]
R: ATGTACACAAGGAAGCATTCAGG 115151 8 0.8324 0.8421 [0.2652]
Mut06 (AAAC)7 MF425757 F: TTGAACACTAATCTCGCCATTGC PET 110–130 6 0.6983 0.6984 [0.5816]
R: GTGGGATATGAGGAAAGAGTTGC 114126 4 0.5541 0.2093 [0.0001]***
Mut08 (AAGC)6 MF425758 F: TACTACTTTCTGAACTCTGCTGC VIC 122–176 9 0.8332 0.7705 [0.0032]*
R: GAGAGAAGAAGGAACAAACAAGC 122201 11 0.8722 0.7105 [0.0037]*
Mut09 (AGAT)10 MF425759 F: CACTCTAGTTCAACCTGTTCAGC VIC 125–161 8 0.8083 0.7931 [0.3421]
R: CTCTTAGAGAATTTGCTGCTGTG 125153 8 0.8072 0.4250 [0.0000]***
Mut12 (AAAC)6 MF425760 F: GGAAGGAGCTTACACATAGGAAC NED 123–150 7 0.7448 0.5932 [0.0000]**
R: GGAGGATCTTGTACTTGCAGTTG 146154 6 0.5971 0.5814 [0.4043]
Mut14 (AAAC)5 MF425761 F: TCTGCCAACTTCTTTATGCTGTC FAM 154–174 6 0.6596 0.6825 [0.4565]
R: TTCTTTCAATTCATTAGCCCAGTG 148160 4 0.1358 0.0952 [0.0478]*
Mut16 (AGAT)12 MF425762 F: TGCTGTAATTGGCTAGTGGTTTC NED 155–171 5 0.6658 0.6452 [0.4086]
R: CGGTCAGGTGTTTCTCAGTAAAG 151183 9 0.8164 0.7209 [0.0275]*
Mut17 (AAAG)15 MF425763 F: CCAAGAACACAGAAATCCCAGAG PET 134–226 18 0.7586 0.6207 [0.0105]*
R: TGTTAATTGACTGCCACAAACTAC 126174 5 0.4207 0.3514 [0.1756]
Mut18 (AAAC)6 MF425764 F: TTCACTCATAACTAAGCAAAGCAG FAM 171–183 4 0.6122 0.5690 [0.0747]
R: TGCATTGGAATTACTGTTGATGC 178183 3 0.4436 0.4048 [0.3302]
Mut20 (ATCC)13 MF425765 F: CTTTCCACCTTTCTTACTGCCTG PET 173–213 11 0.8692 0.7500 [0.0068]*
R: CTCATCCTGTATTTCTGAGCTGC 157217 13 0.8430 0.7143 [0.0344]*
Mut22 (AAAC)6 MF425766 F: GTGGTATCTCTGTAACTTGGGAG FAM 179–195 3 0.4259 0.4444 [0.6885]
R: AAGGCAAAGCAAGAATGTCTGTG 179191 4 0.6684 0.6098 [0.2344]
Mut23 (AGAT)9 MF425767 F: CTGGAGTCTAGAATTGCCACAAC NED 173–209 10 0.8206 0.7833 [0.1645]
R: AGGGTCAAGAACTTACAATGGAC 173197 7 0.7064 0.7027 [0.3735]
Mut24 (AAAG)5 MF425768 F: AACTGACAATCAAGCATCTCATG PET 198–202 2 0.1244 0.1333 [1.0000]
R: CTGCTATGTACTACTCAAGGTGC NA NA NA NA
  1. NA, no available data for the species; Na, number of observed alleles; HO, observed heterozygosity; HE, expected heterozygosity
  2. Brackets: p values for the exact tests of departure from Hardy–Weinberg proportions (H1 heterozygosity deficit)
  3. * p < 0.05, ** p < 0.0031 (Bonferroni correction for the rock ptarmigan), *** p < 0.0033 (Bonferroni correction for the willow grouse)