Skip to main content

Table 1 Primers used in this study

From: enChIP systems using different CRISPR orthologues and epitope tags

Number Name Sequence (5′ → 3′) Experiments
27222 hSox2-prom-F attggtcgctagaaacccatttatt Real-time PCR in Figs. 1e and 2d (SOX2)
27223 hSox2-prom-R ctgccttgacaactcctgatacttt Real-time PCR in Figs. 1e and 2d (SOX2)
27310 hIRF1-prom-F cgcctgcgttcgggagatatac Real-time PCR in Figs. 1e and 2d (IRF1)
27312 hIRF1-prom-R1 + 2 ctgtcctctcactccgccttgt Real-time PCR in Figs. 1e and 2d (IRF1)