Skip to main content

Table 1 Primer sequences, product sizes and conditions used in the triplex and simplex PCRs

From: Multiplex PCR for the simultaneous detection of the Enterobacterial gene wecA, the Shiga Toxin genes (stx1 and stx2) and the Intimin gene (eae)

Primer sets Target genes Primers MgCl2 (mM) Product size (bp)
Names Sequences (5′–3′)a μM
A wecA Meca202U GGGTTGTCCTGCGTCTCGTT 0.05 3 452
Meca633L TATTCTGCCAGCACGCCAATG
stx1 and stx2 UstxU1 TRTTGARCRAAATAATTTATATGT 0.5 526 (stx1)
UstxL1 MTGATGATGRCAATTCAGTAT 523 (stx2)
stxA 2f UstxU3 AATGGAACGGAATAACTTATATGT 0.05 523
UstxL3 GGTTGAGTGGCAATTAAGGAT
eae intimin Ueae28U ACCCGGCACAAGCATAAG 0.1 741
Ueae748L CGTAAAGCGRGAGTCAATRTA
B stx1 and stx2 UstxL1 MTGATGATGRCAATTCAGTAT 0.1 3  
stx 1 Nestx1 GTACAACACTKGATGATCTC 0.3 200
stx 2 Nestx2 TGACRACGGACAGCAGT 0.05 410
C wecA Meca480UU21 GGATATGGTGGCGATTATGTA 0.2 2 226
Meca685LU21 GAATGCTAGCAAAAAGAGCAC
Meca479UU21 TGGATATGGTGGCGATTATGT 0.2 2 261
Meca722LU18 TCCAGGCMCGCTTAATGC
  1. Triplex PCR (A) semi-nested duplex PCR for stx1 and stx2 typing (B) and simplex PCR for Enterobacteriaceae (C)
  2. aR = A or G, M = A or C, K = G or T