Skip to main content

Table 1 Oligodeoxyribonucleotides used in this study

From: An enChIP system for the analysis of bacterial genome functions

Number Name Sequence (5′ → 3′) Experiments
27816 E. coli gRNA common S agttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttga Construction of plasmids targeting the rpoH gene promoter
27817 E. coli gRNA common A agcttcaaaaaaagcaccgactcggtgccactttttcaagttgataacggactagcct Construction of plasmids targeting the rpoH gene promoter
27818 rpoH p 158–180 S ctagtgttatactctttccctgcaagttttagagctagaaatagca Construction of the plasmid targeting the rpoH gene promoter 158–180
27819 rpoH p 158–180 A tattttaacttgctatttctagctctaaaacttgcagggaaagagtataaca Construction of the plasmid targeting the rpoH gene promoter 158–180
27820 rpoH p 184–206 S ctagtcggggtctctttccctgctagttttagagctagaaatagca Construction of the plasmid targeting the rpoH gene promoter 184–206
27821 rpoH p 184–206 A tattttaacttgctatttctagctctaaaactagcagggaaagagaccccga Construction of the plasmid targeting the rpoH gene promoter 184–206
27792 LacZ-E. coli-F gcgattaccgttgatgttgaagt Real-time PCR in Figs. 1d and 2d (LacZ)
27793 LacZ-E. coli-R agtaaggcggtcgggatagtttt Real-time PCR in Figs. 1d and 2d (LacZ)
27794 LacZ-E. coli-F2 aaaactatcccgaccgccttact Real-time PCR in Fig. 1d (LacZ(2))
27795 LacZ-E. coli-R2 gggaagacgtacggggtatacat Real-time PCR in Fig. 1d (LacZ(2))
27796 crp-E. coli-F tcacttcagagaaagtgggcaac Real-time PCR in Fig. 1d (crp)
27797 crp-E. coli-R gtcatagcgtctggttgttttgc Real-time PCR in Fig. 1d (crp)
27798 LacI-E. coli-F cgtcagtgggctgatcattaact Real-time PCR in Fig. 1d (LacI)
27799 LacI-E. coli-R atcaagaaataacgccggaacat Real-time PCR in Fig. 1d (LacI)
27902 rpoH-E. coli-F aagcttgcattgaacttgtggat Real-time PCR in Fig. 2d (rpoH-prom)
27903 rpoH-E. coli-R tatcttctggcgcttcagtggta Real-time PCR in Fig. 2d (rpoH-prom)
27896 rpoH-coding-F tacgttctgcgtaactggcgtat Real-time PCR in Fig. 2d (rpoH-cod)
27897 rpoH-coding-R accatttcgacttcatcctggtt Real-time PCR in Fig. 2d (rpoH-cod)