From: An enChIP system for the analysis of bacterial genome functions
Number | Name | Sequence (5′ → 3′) | Experiments |
---|---|---|---|
27816 | E. coli gRNA common S | agttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttga | Construction of plasmids targeting the rpoH gene promoter |
27817 | E. coli gRNA common A | agcttcaaaaaaagcaccgactcggtgccactttttcaagttgataacggactagcct | Construction of plasmids targeting the rpoH gene promoter |
27818 | rpoH p 158–180 S | ctagtgttatactctttccctgcaagttttagagctagaaatagca | Construction of the plasmid targeting the rpoH gene promoter 158–180 |
27819 | rpoH p 158–180 A | tattttaacttgctatttctagctctaaaacttgcagggaaagagtataaca | Construction of the plasmid targeting the rpoH gene promoter 158–180 |
27820 | rpoH p 184–206 S | ctagtcggggtctctttccctgctagttttagagctagaaatagca | Construction of the plasmid targeting the rpoH gene promoter 184–206 |
27821 | rpoH p 184–206 A | tattttaacttgctatttctagctctaaaactagcagggaaagagaccccga | Construction of the plasmid targeting the rpoH gene promoter 184–206 |
27792 | LacZ-E. coli-F | gcgattaccgttgatgttgaagt | |
27793 | LacZ-E. coli-R | agtaaggcggtcgggatagtttt | |
27794 | LacZ-E. coli-F2 | aaaactatcccgaccgccttact | Real-time PCR in Fig. 1d (LacZ(2)) |
27795 | LacZ-E. coli-R2 | gggaagacgtacggggtatacat | Real-time PCR in Fig. 1d (LacZ(2)) |
27796 | crp-E. coli-F | tcacttcagagaaagtgggcaac | Real-time PCR in Fig. 1d (crp) |
27797 | crp-E. coli-R | gtcatagcgtctggttgttttgc | Real-time PCR in Fig. 1d (crp) |
27798 | LacI-E. coli-F | cgtcagtgggctgatcattaact | Real-time PCR in Fig. 1d (LacI) |
27799 | LacI-E. coli-R | atcaagaaataacgccggaacat | Real-time PCR in Fig. 1d (LacI) |
27902 | rpoH-E. coli-F | aagcttgcattgaacttgtggat | Real-time PCR in Fig. 2d (rpoH-prom) |
27903 | rpoH-E. coli-R | tatcttctggcgcttcagtggta | Real-time PCR in Fig. 2d (rpoH-prom) |
27896 | rpoH-coding-F | tacgttctgcgtaactggcgtat | Real-time PCR in Fig. 2d (rpoH-cod) |
27897 | rpoH-coding-R | accatttcgacttcatcctggtt | Real-time PCR in Fig. 2d (rpoH-cod) |