Skip to main content

Table 1 Primers of the five new SSRs used to map the dwarf trait and the two primers for SNP genotyping

From: Identification of a new allele of the Dw gene causing brachytic dwarfing in peach

Primer name Primer sequence Genomic position
CPP24554-F TGAGGGAAGTTTGGTTGCTC 6:28182155
CPP24554-R AATTGAGATGAATGGGGCGC 6:28182388
CPP24650-F GGCACGTGAGAGGGATATGA 6:28892277
CPP24650-R AACTTAAGTCAGCGGCAGGAT 6:28892516
CPP24654-F GGGGTAAATAAGACTTTTGACAACT 6:28897444
CPP24654-R AGTCGGTCTAAGGTGTGAAAACA 6:28897685
CPP24664-F ATTAAACCACAGACGCACGG 6:28996880
CPP24664-R TGACCATGTGCGTATCATTTGT 6:28997069
CPP24681-F TTCCCTGCTTGACACGTGTA 6:29123267
CPP24681-R ACACTCACTCTGTCTTCCGGT 6:29123396
ppa018174-F AACTGGCCTGCTTACTCGAA 6:28967552
ppa018174-R GCCAGTCCTGAACAAGATCC 6:28966891
  1. Genomic positions are according to the Prunus genome v2.0