Skip to main content

Advertisement

Table 1 Sequences of primers used

From: Distribution of resistance genes encoding ESBLs in Enterobacteriaceae isolated from biological samples in health centers in Ouagadougou, Burkina Faso

Genes Primers Sequence (5′–3′) Weight (pb) Accession number
blatem a 216 (+) ATAAAATTCTTGAAGACGAAA 1079 AB282997
a 217 (−) GACAGTTACCAATGCTTAATCA
blashv os-5 (+) ATTTGTCGCTTCTTTACTCGC 1051 X98098
os-6 (−) TTTATGGCGTTACCTTTGACC
blactx-M ctxM1 (+) GGTTAAAAAATCACTGCGTC 863 X92506
ctxM1 (−) TTGGTGACGATTTTAGCCGC
ctxM2 (+) ATGATGACTCAGAGCATTCG 865 X92507
ctxM2 (−) TGGGTTACGATTTTCGCCGC
ctxM9 (+) ATGGTGACAAAGAGAGTGCA 869 AF174129
ctxM9 (−) CCCTTCGGCGATGATTCTC