Skip to main content

Advertisement

Table 1 Specifications of designed primers

From: Prevalence and distribution of adhesins and the expression of fibronectin-binding protein (FnbA and FnbB) among Staphylococcus aureus isolates from Shahrekord Hospitals

Gene Primer sequence(5′ to 3′) Product length (bp)
fnbAF TGGTACTGATGAAGTTGATTTTAGAAC 101
fnbAR CATTATCCCAAGTTAAGGTATATCCTC
clfBF CCGGTAGTAAATGCTGCTGTA 103
clfBR CACTTTGATTAGGGTCAAATGTAGTC
16sF GGTCTGTAACTGACGCTGATGTG 68
16sR GTGGACTACCAGGGTATCTAATCCT
fnbBF GGAGCGGCCTCAGTATTCTT 201
fnbBR AGTTGATGTCGCGCTGTATG
clfAF CGCCGGTAACTGGTGAAGCT 314
clfAR TGCTCTCATTCTAGGCGCACTT