Skip to main content

Table 1 Summary details for 17 microsatellite loci developed for Mobula alfredi

From: Development and characterization of 17 polymorphic microsatellite markers for the reef manta ray (Mobula alfredi)

Locus NCBI reference Repeat motif Primer sequence (5′-3′) Fluoro label n A Observed allele size range (bp) HO HE P HWE
MAQDD04 MK225654 GAA(27) F: ACATCCTGCAGAGGCTGTAA
R: TCCTTATCTTGTTCCGGCAG
VIC 60 10 363–393 0.88 0.82 0.71
MAQDD09 MK225655 TG(15) F: CGTCGACTGTTCACACTTCC
R: CTTCCTGGCTGGTAGGTACG
FAM 60 5 190–206 0.62 0.59 0.59
MAQDD11 MK225656 TC(19) F: TTTACCTATAGATGGGTCAGGGAC
R: GCAGATCGCTGTAGCTGTGA
NED 60 8 204–224 0.92 0.85 0.07
MAQDD12 MK225657 AC(19) F: AAAGGATCTGGGAATACGGG
R: GTGTTGGGATCTCTGGTGCT
FAM 60 4 149–155 0.32 0.36 0.48
MAQDD18 MK225658 TG(13) F: GGGAGACATTGAAACGTGTG
R: GAATGTGATGGAGAGCACTTG
FAM 60 3 137–149 0.30 0.38 0.11
MAQDD21 MK225659 TG(13) F: GGCATACAAAGTGCTGGAGG
R: ATCTCAACCCTGCGTGGAC
NED 60 13 270–314 0.65 0.69 0.24
MAQDD22 MK225660 AC(17) F: CGGAATAGCTGACCCTCAGA
R: ATTGTGATGGAGTGGTCCGT
FAM 60 3 134–138 0.68 0.55 0.18
MAQDD23 MK225661 AC(10) F: CCCATCACTGATAATGAGCGT
R: GTGCAGTCAAAGGAATGGGT
FAM 60 2 148–150 0.35 0.50 0.02
MAQDD26 MK225662 AC(16) F: ATGTCAACCGGACTGGAAAT
R: TGTATGCGTATCTAGCATCTTCA
PET 60 6 203–33 0.62 0.59 0.08
MAQDD28 MK225663 AC(23) F: GCTGCAGGGAAGAAGCTAAA
R: TTTGTCCGAATATCTTGCCA
NED 60 6 151–165 0.58 0.55 0.95
MAQDD29 MK225664 GT(21) F: GCTGAGAGGAAGCTATTGGC
R: GAAGATACAGGAAGATAAATTGGCA
FAM 60 8 193–213 0.63 0.60 0.90
MAQDD31 MK225665 AC(20) F: AACTGCCCATTCACATTTCC
R: CCCATAGCTACCATCAGGGA
PET 60 13 282–314 0.72 0.72 0.34
MAQDD33 MK225666 CA(21) F: GACGAGACATCCCAAACACC
R: TTTCCTGGATCCACAACCTC
FAM 60 7 200–228 0.65 0.59 0.31
MAQDD37 MK225667 GT(14) F: CGTTGCATCCATCTGACGTA
R: GATGCACCAGAGCAACCAC
PET 60 4 170–192 0.58 0.51 0.36
MAQDD38 MK225668 CA(14) F: CCAAACATAACCCAGGCAAG
R: CAGCCTTGGTGAACTGAGTG
VIC 60 5 156–172 0.65 0.68 0.96
MAQDD39 MK225669 GT(14) F: AGCAGCTCTGTGGAAGCAGT
R: GCACCCATTTCCAATCAGTT
FAM 60 2 360–362 0.65 0.50 0.04
MAQDD43 MK225670 AC(14) F: TCCCTGGCTGTATTGCCTAC
R: AACCCTCGGATATCCATTCTC
NED 60 7 162–184 0.80 0.73 0.55
  1. NCBI National Center for Biotechnology Information GenBank Reference; Primer Sequence F forward, R reverse (All forward primers had a GTT on the 3′ end & all reverse primers had CAG tag on the 5′ end (not included here), n is the number of individuals genotyped, A is the number of alleles observed, HO is the observed heterozygosity, HE is the expected heterozygosity, PHWE is the probability of the locus deviating from Hardy–Weinberg equilibrium