Skip to main content

Advertisement

Table 1 Primer sequences, motifs, and characteristics of the 11 microsatellite loci developed and optimized from the black vulture (Coragyps atratus)

From: Development of microsatellite loci for two New World vultures (Cathartidae)

Locus Panel Dye label Primer sequence (5′–3′); F, forward; R, reverse Repeat motif n Size range (bp) N A H O H E
BLVU-36 A 6-FAM F: CTGAACGGAAACAGAGCTGC AAAG(7) AACG(6) 30 223–242 4 0.68 0.66
R: CACTATGACCCCTTATGACTCTGG
BLVU-11a,b A VIC F: CTTGAAGAGCAAAGTCGGGG AGT(13) TTC(11) 30 225–237 3 0.10 0.42
R: AGGACAAATGTGCCTTTCGG
BLVU-37 A PET F: CTAATGGCTCCAGACCCAGG TATC(12) 30 258–266 3 0.52 0.46
R: TTTTGTCCACCTCCTGTCCC
BLVU-05a,b B 6-FAM F: GACCTATCCACATGAATGCC GA(37) AG(17) 30 295–317 9 0.32 0.64
R: GCCTCTGTTAGTATTCCATCCCC
BLVU-38a,b B 6-FAM F: TGTCACCTGGAGCTCTGTCC ATCT(13) 30 168–188 5 0.29 0.62
R: TCATTAGCATGAAATGAAGGTGC
BLVU-09 B VIC F: CCTCCATAGATGTGCCCTAACC GAAA(12) AAGG(18) 30 272–320 5 0.39 0.39
R: ACAGCTTCTCCCTGTGTCCC
BLVU-18 B PET F: CTCTCTCTAACCGGCTCTACGC GTT(10) 30 117–123 2 0.06 0.06
R: GAAGAAGAGAGAGGCGGCG
BLVU-33 C 6-FAM F: GGGTAGCAAGAGAAAGAGGGG AGAC(6) GGAA(7) 30 350–406 11 0.71 0.84
R: ATTGTGCATTTCCTCCTGGC
BLVU-39 C VIC F: CTTCCTTCCTCTGCCTGC TGCC(14) 30 109–129 5 0.74 0.70
R: TGAACAGGACTTGATTGTCTCC
BLVU-40 C NED F: CCTCTATTGGCTTCAGCAGG TTCC(8) 30 274–282 3 0.45 0.50
R: GCAAGAGGAAGAGTGGAAGG
BLVU-27 C PET F: CCAAAACCTGCCACTGTCC AAAT(12) 30 214–226 3 0.65 0.59
R: GGTGACATTTTAATGCTGGGC
  1. n is the sample size, NA is the number of alleles, HO is the observed heterozygosity, and HE is the expected heterozygosity
  2. aShowed significant deviation from Hardy–Weinberg equilibrium after Bonferroni corrections [20]
  3. bShowed evidence of null alleles