Skip to main content

Advertisement

Table 2 Primer sequences, motifs, and characteristics of the 14 microsatellite loci developed and optimized from the turkey vulture (Cathartes aura)

From: Development of microsatellite loci for two New World vultures (Cathartidae)

Locus Panel Dye label Primer sequence (5′–3′); F, forward; R, reverse Repeat motif n Allele size range (bp) N A H O H E
TUVU-21b A 6-FAM F: TTGTTTGGCTCCATGTTTGG CT(10) AC(8) AC(10) 30 202–210 3 0.20 0.39
R: ACACCCATTCAAATGCAAGC
TUVU-06 A 6-FAM F: GAGTCAGCAATGGTGGTTGC GAA(25) GAA(8) 30 326–533 17 0.77 0.83
R: ACTGTAGCAGTGACGGCAGC
TUVU-31 A VIC F: AAGTAAATAGCTGTCTAACTGTTCATCC TG(15) AT(8) 30 122–152 8 0.73 0.81
R: CTTTCATGCCTTGATTTCCC
TUVU-23 A NED F: GAAACGGTATTTGCCTTGCC TTCC(12) 30 155–161 6 0.60 0.60
R: AAAACTCCAAGGGGAGGAGG
TUVU-39b A PET F: GGTTCAGGTGAGAGAAACCCC AAAG(23) 30 188–311 20 0.77 0.90
R: GAAAACCCCTCTGGGAAACC
TUVU-14a,b B 6-FAM F: CCTAGTCCGGAAACACAGGG ATT(14) ATT(6) 30 347–371 7 0.50 0.75
R: TTAAACTGAAATGTGTGAAGAAGCG
TUVU-07 B 6-FAM F: TGGGATGTGAAGGAGAACAGC GGAA(28) 30 160–226 15 0.87 0.92
R: TGACTCCTGTACAAAATTAGATCCTTCC
TUVU-45 B VIC F: AATAATCCATGAGCACCAGGC GTTT(14) 30 131–158 7 0.50 0.45
R: CCCATAAACTCAAGCATTGGC
TUVU-03 B PET F: AGGTTCATTAGCAGAGGCGG AAAG(9) AAAG(18) 30 261–375 30 1.00 0.96
R: GTGGCAGAAAGAAGCTGAAGG
TUVU-01 C 6-FAM F: TCATACACTGGTCGTTCGCC TC(6) CTTT(24) CTTT(12) 30 290–640 47 1.00 0.99
R: ATTGAAATGCCCTACAGACGG
TUVU-18 C VIC F: GGTTCTGCTGATTTCAACTTTGC TAA(11) TGA(9) 30 240–249 4 0.50 0.47
R: TTCACCACAGGAAACCAAAGC
TUVU-37 C NED F: GCTGGTTTTGAACAGTGAGGG AAAG(27) AAAG(8) 30 263–415 34 0.93 0.97
R: TTACAGGTGGGGAATCTCAGG
TUVU-33 C PET F: GCAAATCAGCCTCTGGTGG TA(13) TA(6) 30 330–339 9 0.77 0.83
R: TTAACTTGGAGGCCAGGAGG
TUVU-36a,b C PET F: CACACGCACACAATGCACC GC(8) 30 169–173 3 0.07 0.45
R: CACTGCGCGAGTGTGAGG
  1. n is the sample size, NA is the number of alleles, HO is the observed heterozygosity, and HE is the expected heterozygosity
  2. aShowed significant deviation from Hardy–Weinberg equilibrium after Bonferroni corrections [20]
  3. bShowed evidence of null alleles