Skip to main content

Table 1 Species specific primers for PCR assay [15]

From: Frequency of putative periodontal pathogens among type 1 diabetes mellitus: a case–control study

Primer pairs (5′–3′), 16S rRNA Amplicon length in bp
Eikenella corrodens
 CTAATACCGCATACGTCCTAAG 688
 CTACTAAGCAATCAAGTTGCCC
Campylobacter rectus
 TTTCGGAGCGTAAAACTCCTTTTC 598
 TTTCTGCAAGCAGACACTTTT
Prevotella intermedia
 TTTGTTGGGGATAAAGCGGG 575
 TCAACATCTCTGTATCCTGCGT
Prevotella nigrescens
 ATGAAACAAAGGTTTCCGGTAAG 804
 CCCACGTCTCTGTGGGCTGCGA