Skip to main content

Table 1 Primers used in our study

From: Ability of real-time PCR for differential diagnosis of various forms of cutaneous leishmaniasis: a comparative study with histopathology

Primers Sequences (5′–3′)
L.ITS.F 5′-CAAATACACGCATGCACTCTC-3′
L.ITS.R 5′-TTTAATAATCCTGGTCACAGCC-3′
L.ITS.P FAM-5′AGCGTCGAAACTCCTCTCTGGTGC3′-TAMRA
Actin.F 5′-ACCACCTTCAACTCCATCATG-3′
Actin.R 5′-CTCCTTCTGCATCCTGTCG-3′
Actin.P JOE-5′ ACATCCGCAAAGACCTGTACGCC 3′-TAMRA
  1. F forward, R reverse, P probe, L.ITS leishmania ITS (internal transcribed spacer) gene