Skip to main content

Table 1 Characteristics of the 15 microsatellite markers developed for Thuja standishii

From: Development of microsatellite markers for the Japanese endemic conifer Thuja standishii and transfer to other East Asian species

Locus Primer (5′-3′) Repeat motif Allele size range (bp) BlastX top hit description E-value Genbank accession
Kurobe_18480 F: TCAGGACCCCAACAAATAAA
R: GATGCTGGAGATGGTATTTCG
(AT)9 135–189 Unknown [Picea sitchensis] ABR17033.1 3E−95 MN170833
Kurobe_2969 F: ACACAATCTTGCCCAGAAGC
R: ACACAATCTTGCCCAGAAGC
(TA)8 269–291 WRI2 [Larix gmelinii var. olgensis x L. kaempferi] AJP75043.1 0 MN170828
Kurobe_23700 F: CCGACGCCTCTACATTCATT
R: ATGGAAAAGAGGCAGAGCAA
(TCT)10 250–268 Hypothetical protein MARPO_0043s0052 [Marchantia polymorpha] PTQ39804.1 2E−39 MN170835
Kurobe_44557 F: GATCCCTTTTGATGGGTTCA
R: TTATCCCCAACTTCAGCGAG
(TC)11 313–349 MN170841
Kurobe_15129 F: TTAACATCCACCAATGGCAA
R: CAAATGCATGGAATGTGGTC
(TC)12 205–233 Unknown [Picea sitchensis] ABK22564.1 9E−66 MN170831
Kurobe_16758 F: TGCAACGTCATAACCACGAT
R: CACCCTTCTAGAGCTGGTCG
(CT)8 272–283 CYP866B7 [Taxus chinensis] ATG30002.1 0 MN170832
Kurobe_6943 F: CTACGTCTTAGCCTCCACGC
R: ATGCCATACTGGGGTCTGAG
(CT)11 159–169 Early nodulin-like protein 2 [Amborella trichopoda] XP_011628802.2 4E−37 MN170830
Kurobe_23263 F: CCAGGCCCTAATTTCCACTC
R: CCATGGCACATGGATACAGA
(AG)10 290–314 MN170834
Kurobe_51603 F: CAAAGCAACAGAGCCAACAA
R: AAATAGGGTGCTGCAGGTTG
(TG)13 162–201 MN170842
Kurobe_31302 F: TCCCAAGTCTGGGGCAGT
R: GTCACAGTCGGGAGCAATTT
(GT)8 264–274 MN170836
Kurobe_38308 F: TTTGCTGAAACCCAGGAATC
R: CCCCATATGGAAGAAGATCC
(TG)11 272–297 MN170837
Kurobe_41636 F: TTGAACTTTGCAGTGGGAAA
R: GAACCAGACAGGAATCGGAA
(CA)8 157–165 MN170839
Kurobe_42400 F: TTCACACAAGGGCCTACTCC
R: GCCGACAGGTCTCTTAGCAC
(TC)9 254–272 MN170840
Kurobe_40825 F: TTATCCCATGAGCGTGCTTT
R: TAGGTGCGGTGACTATGCAG
(CT)8 232–276 MN170838
Kurobe_4219 F: ACGCATCGGACAGTCGTATT
R: CCGTGCAGAACCAAAGAAAT
(TC)8 276–306 MACPF domain-containing protein At4g24290 [Morus notabilis] XP_010087924.1 0 MN170829
  1. – denotes that no BlastX hits were found