Skip to main content

Table 1 Characteristics of 17 microsatellite loci in two collections of Cicindela dorsalis dorsalis, and one collection of C. dorsalis media

From: Development of microsatellite markers for three at risk tiger beetles Cicindela dorsalis dorsalis, C. d. media, and C. puritana

LocusPrimer sequencesSize rangeMultiplexMotifLocus originLocus characteristicMV n = 16 (C. dorsalis dorsalis)CI n = 20 (C. dorsalis dorsalis)FI n = 24 (C. dorsalis media)
Cdo4F: ACAAAGAAAGAGACTCGCCC141–1564 FAMAAC(9)CddNA1.002.002.00
 R: CACACGTTTCAGGGATGGAC    HO0.000.200.04
      uHE0.000.190.04
      AE1.001.221.04
      Microchecker nullNoNoNo
      Micorochecker scoring errorNoNoNo
      HWE P-valueNA1.00NA
Cdo5F: TGTGTGTCCTATATTAGCTGATGC139–1483 VICAAT(9)CdmNA1.001.003.00
 R: GCGAGGCTATAAATATGCACTT    HO0.000.000.54
      uHE0.000.000.53
      AE1.001.002.06
      Microchecker nullNoNoNo
      Micorochecker scoring errorNoNoNo
      HWE P-valueNANA0.30
Cdo6F: TCTCAGGATTACGAAGCAGAAA123–1291 VICAAT(10)CddNA1.002.002.00
 R: GTACGATCGTCCTGCCCA    HO0.000.500.17
      uHE0.000.490.22
      AE1.001.921.28
      Microchecker nullNoNoNo
      Micorochecker scoring errorNoNoNo
      HWE P-valueNA1.000.30
Cdo7F: CATTCTATATTCCTAAAGGGTTCC105–1114 VICAAT(9)CdmNA2.002.003.00
 R: CACCTACGACACACGTATAGTTACA    HO0.130.050.21
      uHE0.120.050.19
      AE1.131.051.24
      Microchecker nullNoNoNo
      Micorochecker scoring errorNoNoNo
      HWE P-value1.00NA1.00
Cdo8F: AGCAGGCGTGTCGTGTTTAT133–1392 FAMAAT(9)CdmNA3.002.003.00
 R: TGCTCAACCCTGAAGGAAGT    HO0.880.300.46
      uHE0.570.430.46
      AE2.251.721.83
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-value0.010.281.00
Cdo11CGTTTGGCAAGGTTAGTTC123–1352 PETAAT(9)CdmNA2.002.005.00
 AAATTCCGTTTGACGGTGA    HO0.310.350.71
      uHE0.420.360.68
      AE1.681.543.03
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-value0.531.000.99
Cdo13TTCGATTCTTCGACTTGTTTCA260–2783 PETAAC(8)CdmNA3.003.007.00
 TGAAATTTGATTGGCATACAGG    HO0.630.450.92
      uHE0.640.570.83
      AE2.602.245.38
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-value0.600.500.44
Cdo15GGGATAGAAAGGAGTTGGGTG133–1392 VICAAG(8)CdmNA1.001.003.00
 ACACTACTCGAGAACATCACCA    HO0.000.000.21
      uHE0.000.000.53
      AE1.001.002.08
      Microchecker nullYesYesYes
      Microchecker scoring errorYesYesYes
      HWE P-valueNANA0.00
Cdo21AAGGCCGCAGTACAAGGAC144–1501 PETAAT(8)CdmNA1.002.003.00
 AAACAGTTGTGCCGATAAATCTT    HO0.000.150.58
      uHE0.000.140.57
      AE1.001.162.25
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-valueNA1.000.06
Cdo24GAACAGGGACTGTTGTGGC105–1204 NEDAGC(8)CddNA2.002.005.00
 ACCTGGTGGAGCGTCGTT    HO0.060.300.48
      uHE0.060.260.49
      AE1.061.341.91
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-valueNA1.001.00
Cdo25CGTTTATTGAGCCGGTGTTA104–1254 PETCCG(8)CddNA4.004.006.00
 GAACGGGCGATGTTTGAC    HO0.310.650.92
      uHE0.290.620.75
      AE1.382.523.77
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-value1.000.590.12
Cdo28AGGATGGTTATCAATTTGGC228–2431 FAMAAT(14)CddNA2.001.003.00
 CGACTAACAAATAGCCATACACA    HO0.130.000.09
      uHE0.230.000.24
      AE1.281.001.31
      Microchecker nullYesYesYes
      Microchecker scoring errorNoNoNo
      HWE P-value0.19NA0.00
Cdo29CGCTGCCGATAGTACAAAT135–1751 FAMACAGT(12)CdmNA2.002.007.00
 CCCATCCCTGCCTTATTCTAT    HO0.130.100.17
      uHE0.230.490.54
      AE1.281.922.11
      Microchecker nullYesYesYes
      Microchecker scoring errorNoNoNo
      HWE P-value0.190.000.00
Cdo30AACTTTGACCAATTGTGTTGG143–1492 NEDAAT(10)CddNA2.002.003.00
 AAGGAAATTATTATTTGTTCGCAA    HO0.500.250.46
      uHE0.390.220.44
      AE1.601.281.76
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-value0.511.000.33
Cdo33GGATTGTAATTGAATGTGATTTGTG266–2863 FAMACCT(9)CdmNA2.002.005.00
 ATGTTATCTTCCGACCGTGG    HO0.380.100.79
      uHE0.440.100.79
      AE1.751.114.38
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-value0.591.000.28
Cdo38ATTCCACACGACTCCCTGTC128–1433 NEDAGC(9)CddNA1.002.005.00
 TGCGGTGTTGCACTATTGAT    HO0.000.550.79
      uHE0.000.510.65
      AE1.002.002.78
      Microchecker nullNoNoNo
      Microchecker scoring errorNoNoNo
      HWE P-valueNA1.000.04
Cdo41AAAGTCCACCGTTAGCACC97–1061 NEDAGC(8)CdmNA2.004.003.00
 GATAACGGTGAGGTGAGTCCA    HO0.000.150.29
      uHE0.440.550.60
      AE1.752.132.42
      Microchecker nullYesYesYes
      Microchecker scoring errorNoNoNo
      HWE P-value0.000.000.00
      NA (mean, SE)1.88, 0.212.12, 0.214.00, 0.39
      HO (mean, SE)0.20, 0.060.24, 0.050.46, 0.07
      uHE (mean, SE)0.23, 0.050.29, 0.050.29, 0.05
      AE (mean, SE)1.40, 0.121.54, 0.122.39, 0.29
      HWE P-value (Fisher’s method)0.00520.00000.0000
  1. “Locus” refers to the name assigned to the microsatellite containing sequence. “Size-range” is the bp size of the alleles genotyped. “Motif” is the repeat motif and number of repeats (in parentheses) identified from the sequence read in QDD. “Multi-plex” refers to the assignment of each locus to one of 4 multiplex PCR reactions along with the fluorophore used. See “Main text” for PCR conditions. “Locus origin” denotes whether the locus was derived from within Cicindela dorsalis media (Cdm) or C. d. dorsalis (Cdd) genomic sequence data, though all loci amplify in both subspecies. “Microchecker null” and “Microchecker scoring error” denote the results of tests in Microchecker for null alleles or scoring errors at each locus. The number of alleles (NA), effective number of alleles (AE), unbiased expected heterozygosity (uHE), observed heterozygosity (HO), were output by the Genalex software. The Hardy–Weinberg P-value is the P-value reported for each locus, and across all loci from Genepop using Fisher’s method at the bottom of the table. “MV” and “CI” refer to the Martha’s Vineyard and Cedar Island collections of C. d. dorsalis, and “FI” to the collection of C. d. media from Fisherman’s Island. See “Methods” of the text for details of these collections
\