Development of microsatellite markers for three at risk tiger beetles Cicindela dorsalis dorsalis , C. d. media , and C. puritana

Aaron W. Aunins; Michael S. Eackles; David C. Kazyak; Michael R. Drummond; Timothy L. King

doi:10.1186/s13104-020-04985-8

Table 1 Characteristics of 17 microsatellite loci in two collections of Cicindela dorsalis dorsalis, and one collection of C. dorsalis media

From: Development of microsatellite markers for three at risk tiger beetles Cicindela dorsalis dorsalis, C. d. media, and C. puritana

Locus	Primer sequences	Size range	Multiplex	Motif	Locus origin	Locus characteristic	MV n = 16 (C. dorsalis dorsalis)	CI n = 20 (C. dorsalis dorsalis)	FI n = 24 (C. dorsalis media)
Cdo4	F: ACAAAGAAAGAGACTCGCCC	141–156	4 FAM	AAC₍₉₎	Cdd	N_A	1.00	2.00	2.00
	R: CACACGTTTCAGGGATGGAC					H_O	0.00	0.20	0.04
						uH_E	0.00	0.19	0.04
						A_E	1.00	1.22	1.04
						Microchecker null	No	No	No
						Micorochecker scoring error	No	No	No
						HWE P-value	NA	1.00	NA
Cdo5	F: TGTGTGTCCTATATTAGCTGATGC	139–148	3 VIC	AAT₍₉₎	Cdm	N_A	1.00	1.00	3.00
	R: GCGAGGCTATAAATATGCACTT					H_O	0.00	0.00	0.54
						uH_E	0.00	0.00	0.53
						A_E	1.00	1.00	2.06
						Microchecker null	No	No	No
						Micorochecker scoring error	No	No	No
						HWE P-value	NA	NA	0.30
Cdo6	F: TCTCAGGATTACGAAGCAGAAA	123–129	1 VIC	AAT₍₁₀₎	Cdd	N_A	1.00	2.00	2.00
	R: GTACGATCGTCCTGCCCA					H_O	0.00	0.50	0.17
						uH_E	0.00	0.49	0.22
						A_E	1.00	1.92	1.28
						Microchecker null	No	No	No
						Micorochecker scoring error	No	No	No
						HWE P-value	NA	1.00	0.30
Cdo7	F: CATTCTATATTCCTAAAGGGTTCC	105–111	4 VIC	AAT₍₉₎	Cdm	N_A	2.00	2.00	3.00
	R: CACCTACGACACACGTATAGTTACA					H_O	0.13	0.05	0.21
						uH_E	0.12	0.05	0.19
						A_E	1.13	1.05	1.24
						Microchecker null	No	No	No
						Micorochecker scoring error	No	No	No
						HWE P-value	1.00	NA	1.00
Cdo8	F: AGCAGGCGTGTCGTGTTTAT	133–139	2 FAM	AAT₍₉₎	Cdm	N_A	3.00	2.00	3.00
	R: TGCTCAACCCTGAAGGAAGT					H_O	0.88	0.30	0.46
						uH_E	0.57	0.43	0.46
						A_E	2.25	1.72	1.83
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	0.01	0.28	1.00
Cdo11	CGTTTGGCAAGGTTAGTTC	123–135	2 PET	AAT₍₉₎	Cdm	N_A	2.00	2.00	5.00
	AAATTCCGTTTGACGGTGA					H_O	0.31	0.35	0.71
						uH_E	0.42	0.36	0.68
						A_E	1.68	1.54	3.03
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	0.53	1.00	0.99
Cdo13	TTCGATTCTTCGACTTGTTTCA	260–278	3 PET	AAC₍₈₎	Cdm	N_A	3.00	3.00	7.00
	TGAAATTTGATTGGCATACAGG					H_O	0.63	0.45	0.92
						uH_E	0.64	0.57	0.83
						A_E	2.60	2.24	5.38
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	0.60	0.50	0.44
Cdo15	GGGATAGAAAGGAGTTGGGTG	133–139	2 VIC	AAG₍₈₎	Cdm	N_A	1.00	1.00	3.00
	ACACTACTCGAGAACATCACCA					H_O	0.00	0.00	0.21
						uH_E	0.00	0.00	0.53
						A_E	1.00	1.00	2.08
						Microchecker null	Yes	Yes	Yes
						Microchecker scoring error	Yes	Yes	Yes
						HWE P-value	NA	NA	0.00
Cdo21	AAGGCCGCAGTACAAGGAC	144–150	1 PET	AAT₍₈₎	Cdm	N_A	1.00	2.00	3.00
	AAACAGTTGTGCCGATAAATCTT					H_O	0.00	0.15	0.58
						uH_E	0.00	0.14	0.57
						A_E	1.00	1.16	2.25
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	NA	1.00	0.06
Cdo24	GAACAGGGACTGTTGTGGC	105–120	4 NED	AGC₍₈₎	Cdd	N_A	2.00	2.00	5.00
	ACCTGGTGGAGCGTCGTT					H_O	0.06	0.30	0.48
						uH_E	0.06	0.26	0.49
						A_E	1.06	1.34	1.91
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	NA	1.00	1.00
Cdo25	CGTTTATTGAGCCGGTGTTA	104–125	4 PET	CCG₍₈₎	Cdd	N_A	4.00	4.00	6.00
	GAACGGGCGATGTTTGAC					H_O	0.31	0.65	0.92
						uH_E	0.29	0.62	0.75
						A_E	1.38	2.52	3.77
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	1.00	0.59	0.12
Cdo28	AGGATGGTTATCAATTTGGC	228–243	1 FAM	AAT₍₁₄₎	Cdd	N_A	2.00	1.00	3.00
	CGACTAACAAATAGCCATACACA					H_O	0.13	0.00	0.09
						uH_E	0.23	0.00	0.24
						A_E	1.28	1.00	1.31
						Microchecker null	Yes	Yes	Yes
						Microchecker scoring error	No	No	No
						HWE P-value	0.19	NA	0.00
Cdo29	CGCTGCCGATAGTACAAAT	135–175	1 FAM	ACAGT₍₁₂₎	Cdm	N_A	2.00	2.00	7.00
	CCCATCCCTGCCTTATTCTAT					H_O	0.13	0.10	0.17
						uH_E	0.23	0.49	0.54
						A_E	1.28	1.92	2.11
						Microchecker null	Yes	Yes	Yes
						Microchecker scoring error	No	No	No
						HWE P-value	0.19	0.00	0.00
Cdo30	AACTTTGACCAATTGTGTTGG	143–149	2 NED	AAT₍₁₀₎	Cdd	N_A	2.00	2.00	3.00
	AAGGAAATTATTATTTGTTCGCAA					H_O	0.50	0.25	0.46
						uH_E	0.39	0.22	0.44
						A_E	1.60	1.28	1.76
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	0.51	1.00	0.33
Cdo33	GGATTGTAATTGAATGTGATTTGTG	266–286	3 FAM	ACCT₍₉₎	Cdm	N_A	2.00	2.00	5.00
	ATGTTATCTTCCGACCGTGG					H_O	0.38	0.10	0.79
						uH_E	0.44	0.10	0.79
						A_E	1.75	1.11	4.38
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	0.59	1.00	0.28
Cdo38	ATTCCACACGACTCCCTGTC	128–143	3 NED	AGC₍₉₎	Cdd	N_A	1.00	2.00	5.00
	TGCGGTGTTGCACTATTGAT					H_O	0.00	0.55	0.79
						uH_E	0.00	0.51	0.65
						A_E	1.00	2.00	2.78
						Microchecker null	No	No	No
						Microchecker scoring error	No	No	No
						HWE P-value	NA	1.00	0.04
Cdo41	AAAGTCCACCGTTAGCACC	97–106	1 NED	AGC₍₈₎	Cdm	N_A	2.00	4.00	3.00
	GATAACGGTGAGGTGAGTCCA					H_O	0.00	0.15	0.29
						uH_E	0.44	0.55	0.60
						A_E	1.75	2.13	2.42
						Microchecker null	Yes	Yes	Yes
						Microchecker scoring error	No	No	No
						HWE P-value	0.00	0.00	0.00
						N_A (mean, SE)	1.88, 0.21	2.12, 0.21	4.00, 0.39
						H_O (mean, SE)	0.20, 0.06	0.24, 0.05	0.46, 0.07
						uH_E (mean, SE)	0.23, 0.05	0.29, 0.05	0.29, 0.05
						A_E (mean, SE)	1.40, 0.12	1.54, 0.12	2.39, 0.29
						HWE P-value (Fisher’s method)	0.0052	0.0000	0.0000

“Locus” refers to the name assigned to the microsatellite containing sequence. “Size-range” is the bp size of the alleles genotyped. “Motif” is the repeat motif and number of repeats (in parentheses) identified from the sequence read in QDD. “Multi-plex” refers to the assignment of each locus to one of 4 multiplex PCR reactions along with the fluorophore used. See “Main text” for PCR conditions. “Locus origin” denotes whether the locus was derived from within Cicindela dorsalis media (Cdm) or C. d. dorsalis (Cdd) genomic sequence data, though all loci amplify in both subspecies. “Microchecker null” and “Microchecker scoring error” denote the results of tests in Microchecker for null alleles or scoring errors at each locus. The number of alleles (N_A), effective number of alleles (A_E), unbiased expected heterozygosity (uH_E), observed heterozygosity (H_O), were output by the Genalex software. The Hardy–Weinberg P-value is the P-value reported for each locus, and across all loci from Genepop using Fisher’s method at the bottom of the table. “MV” and “CI” refer to the Martha’s Vineyard and Cedar Island collections of C. d. dorsalis, and “FI” to the collection of C. d. media from Fisherman’s Island. See “Methods” of the text for details of these collections

Back to article page

ISSN: 1756-0500

Contact us

Submission enquiries: bmcresearchnotes@biomedcentral.com
General enquiries: ORSupport@springernature.com

BMC Research Notes

Contact us